Endeavor to Persevere.

Well as I said last week, my goal for this week was to attempt to discern what may be causing the difficulty with my DNA samples not traveling in the gels.

Upon reviewing the protocols I used for the extraction and PCR process, I noticed two errors on my part that may or may not have been factors. The extraction system that I used called for an initial tissue sample of a size equivalent to a paper hole punch (4-6mm). I used a larger amount of leaf material in my extraction. Also, when I performed the PCR amplification on the extraction, I ran the gel using 2μL of loading dye, 2μL of SYBR green, and 16μL of the DNA. After polling several of the minds at my disposal, it was decided that this may have been too much. I thought that this may be reaching pretty far  for a possible cause to my issues, but as the Sigma-Aldich extraction kit is easy and relatively quick to do, I decided to drop back and do another extraction with the appropriate amount of leaf material to start. When it came time to conduct the gel electrophoresis, I also modified the amounts to: 1μL of loading dye, 1μL of SYBR green, 6μL of ultra pure water, and 2μL of the DNA. This gel did not show favorable results either. Using the same PCR results, I ran yet another gel using 1μL of loading dye, 1μL of SYBR green, and 8μL of the DNA in hopes that maybe I would see something - not the case.

Time for more research...

The URP's that I used were as follows:

1st: URP13R it's sequence of nucleotide bases is: 5'TACATCGCAAGTGACACAGG3'

2nd: URP9F it's sequence of nucleotide bases is: 5'ATGTGTGCGATCAGTTGCTG3'

3rd: URP6R it's sequence of nucleotide bases is: 5'GGCAAGCTGGTGGGAGGTAC3'

In the program for the thermal cycler listed in the previous post, there are divisions of the cycle that are titled denaturing, and annealing. The higher temperature for denaturing is what allows the two strands of the DNA double helix to be unwound. Annealing is the temperature at which the Taq polymerase can add the new complimentary bases to the strand to duplicate it. My research into this led me to a formula on Sigma-Aldrich's website that determines the Tm (melting temperature) of the strand. Ta (annealing temperature) is 5°C less than that. 

The formula: Tm = 4(# of G+C) + 2(# of A+T)°C

Using this and subtracting the 5°C, the annealing temperatures are URP13R - 55°C, URP9F - 55°C, and URP6R - 55°C. It is understood that it is best to go with the lowest Ta. I also found found several different Tm calculators online and they all varied within 51-55°C. So today, using the second extraction of DNA, I ran another PCR and adjusted the annealing temperature to 53°C. I am so hopeful that this will solve the problem that I will go in to the lab tomorrow morning on a day that I am not normally scheduled to run another gel. Let's hope that i see something on the order of this!

Digital photo of the gel. Lane 1. Commercial DNA Markers (1kbplus), Lane 2. empty, Lane 3. a PCR product of just over 500 bases, Lane 4.Restriction digest showing a similar fragment cut from a 4.5 kb plasmidvector

If it comes to pass that this gel is also not productive, my next step will be to combine the previous protocols of the wizard extraction kit with the Sigma-Aldrich system. Basically, as I've said before, the Sigma-Aldrich method is a "quick and dirty" extraction. I can use it initially and the use the wizard kit to "clean up" the extraction. Should I have to do this I will go into much greater detail of the why's and the how's of this next week.

Image from: Gel electrophoresis of nucleic acids. (2014, January 25). Retrieved February 12, 2014, from Wikipedia website: http://en.wikipedia.org/wiki/Gel_electrophoresis_of_nucleic_acids