Another Angle

This week I decided to continue my hiatus from DNA extraction and PCR amplification. There is another angle of my research that I have yet to develop. When taking my samples at Squaw peak, I used an app on my phone to locate each sample's location in terms of GPS coordinates. I also sketched a map of the site.

The overall site sketch

A closer image of the area that I believe I will narrow my study down to.

The arrow points to the line that will correspond with the horizontal axis below

I did this not only so I would be able to return to the specific test subjects if needed (and I did need to), but also knowing that I would like to have a detailed map of some sort within my research paper and presentation. This week I developed a system that will allow me to accurately plot the site in three dimensions. It will be easier to explain the system when I can actually show some pictures of the operation. I am pretty confident it will work very well. What good are the three dimensional coordinates without a good mapping system? Well, none really! I spent some time digging around for good ways to map in three dimensions, and I think I've hit the nail on the head.


This is what I've come up with so far. Keep in mind these numbers are purely fictional. I was just trying to see what I could do with this system. The rough estimates of the overall plot size should be fairly accurate, but the topography is not. I am still working on how to plot the individual trees. We'll see what I can come up with!

Holding Pattern

As the title suggests, this week my experimentation with the Palo Verde was put into a holding pattern. At the end of the spring semester every year there is a student conference held at Estrella Mountain Community College. Each year students submit their research projects in the hopes of being selected to present the results of their work at the conference. As the deadline is fast approaching, this week I worked on developing and polishing an abstract for submission to the panel that reviews student's work for selection to the conference.

There are a few odd things at play here... Submit an abstract before the work is done? Cite references in an abstract? Hmm, why don't we call this what it actually is, a research proposal? OK, so the actual nuts and bolts of writing it were actually not so bad. There is a rubric available, and it always helps to have a guide. Having said that, I am actually concerned about whether or not my work will be accepted. Evidently there is a theme to the conference. This year the theme is "Healthy Body, Healthy Soul." My work on proving cloning in Parkinsonia mycrophilla (the Foothills Palo Verde) as a genetic adaptation for survival in the Sonoran Desert is not really applicable to "Healthy Body, Healthy Soul." So, I have really worked on refining the language in the proposal in order to make it as interesting/intriguing as possible. If I am turned down hopefully I will be able to find another conference to apply to. We shall see...

meme created on makeameme.org

Endeavor to Persevere.

Well as I said last week, my goal for this week was to attempt to discern what may be causing the difficulty with my DNA samples not traveling in the gels.

Upon reviewing the protocols I used for the extraction and PCR process, I noticed two errors on my part that may or may not have been factors. The extraction system that I used called for an initial tissue sample of a size equivalent to a paper hole punch (4-6mm). I used a larger amount of leaf material in my extraction. Also, when I performed the PCR amplification on the extraction, I ran the gel using 2μL of loading dye, 2μL of SYBR green, and 16μL of the DNA. After polling several of the minds at my disposal, it was decided that this may have been too much. I thought that this may be reaching pretty far  for a possible cause to my issues, but as the Sigma-Aldich extraction kit is easy and relatively quick to do, I decided to drop back and do another extraction with the appropriate amount of leaf material to start. When it came time to conduct the gel electrophoresis, I also modified the amounts to: 1μL of loading dye, 1μL of SYBR green, 6μL of ultra pure water, and 2μL of the DNA. This gel did not show favorable results either. Using the same PCR results, I ran yet another gel using 1μL of loading dye, 1μL of SYBR green, and 8μL of the DNA in hopes that maybe I would see something - not the case.

Time for more research...

The URP's that I used were as follows:

1st: URP13R it's sequence of nucleotide bases is: 5'TACATCGCAAGTGACACAGG3'

2nd: URP9F it's sequence of nucleotide bases is: 5'ATGTGTGCGATCAGTTGCTG3'

3rd: URP6R it's sequence of nucleotide bases is: 5'GGCAAGCTGGTGGGAGGTAC3'

In the program for the thermal cycler listed in the previous post, there are divisions of the cycle that are titled denaturing, and annealing. The higher temperature for denaturing is what allows the two strands of the DNA double helix to be unwound. Annealing is the temperature at which the Taq polymerase can add the new complimentary bases to the strand to duplicate it. My research into this led me to a formula on Sigma-Aldrich's website that determines the Tm (melting temperature) of the strand. Ta (annealing temperature) is 5°C less than that. 

The formula: Tm = 4(# of G+C) + 2(# of A+T)°C

Using this and subtracting the 5°C, the annealing temperatures are URP13R - 55°C, URP9F - 55°C, and URP6R - 55°C. It is understood that it is best to go with the lowest Ta. I also found found several different Tm calculators online and they all varied within 51-55°C. So today, using the second extraction of DNA, I ran another PCR and adjusted the annealing temperature to 53°C. I am so hopeful that this will solve the problem that I will go in to the lab tomorrow morning on a day that I am not normally scheduled to run another gel. Let's hope that i see something on the order of this!

Digital photo of the gel. Lane 1. Commercial DNA Markers (1kbplus), Lane 2. empty, Lane 3. a PCR product of just over 500 bases, Lane 4.Restriction digest showing a similar fragment cut from a 4.5 kb plasmidvector

If it comes to pass that this gel is also not productive, my next step will be to combine the previous protocols of the wizard extraction kit with the Sigma-Aldrich system. Basically, as I've said before, the Sigma-Aldrich method is a "quick and dirty" extraction. I can use it initially and the use the wizard kit to "clean up" the extraction. Should I have to do this I will go into much greater detail of the why's and the how's of this next week.

Image from: Gel electrophoresis of nucleic acids. (2014, January 25). Retrieved February 12, 2014, from Wikipedia website: http://en.wikipedia.org/wiki/Gel_electrophoresis_of_nucleic_acids

PCR and junk?

This week I conducted a Polymerase Chain Reaction (PCR) on a sample of the Palo Verde DNA I extracted last week. PCR is a technique used to amplify a sample of DNA. Essentially, PCR creates an extraordinarily large amount of copies of a specific sequence of DNA. I used Universal Rice Primers (URP's) to select specific Simple Sequence Repeats (SSR's) present in the DNA of many species (hence universal rice primer). The primer recognizes these SSR's and singles these sequences out for exponential reproduction. The sample is then introduced into a "Mastermix" that contains free nucleotide bases, and Taq Polymerase, an enzyme that synthesizes the new copies of DNA. The sample, URP's and the mastermix are then placed in a thermal cycler. The thermal cycler runs a program that very specifically cycles the temperature between high and low for certain time frames as follows:

1.     Initial denaturation: 94°C for 3 minutes

2.     Denaturation: 94°C for 1 minute

3.     Annealing: 60°C for 45 seconds

4.     Extension: 72°C for 1 minute

Steps 2-4 repeat 34 times

5.     Final extension: 72°C for 12 minutes

Hold: 4°C indefinitely

The thermal cycler

The Temperature variance is used to assist the reaction's efficiency. The initial high Temperature allows denaturation to occur (separation of the strand of DNA). The cooler Temperature during the annealing stage allows the URP's to bond to the SSR's. During extension, the Taq polymerase adds the new bases that correspond with the nucleotide bases in the DNA strand creating a new segment of DNA. These steps are repeated 34 times so exponential growth occurs in the amount of DNA segments present.

After the PCR was completed, I ran another gel electrophoresis in hopes of seeing good DNA bands. Unfortunately this wasn't the case. The DNA did not appear to travel through the gel. I could see traces of the loading dye that had travelled, so I know that there was not a voltage problem. It is possible the DNA was "junk" DNA, I cannot be sure as yet.  Next week I will run another PCR on the same DNA extraction, as well as complete a new extraction and run it through PCR as well. It is my hope that between these two test I will be able to discern what the issue may be. Until then, here's for hoping...
b