tag:blogger.com,1999:blog-24818376868461864532024-03-14T01:56:54.054-07:00S-STEM Scholar Matthew Hill's BlogAmanda Chapmanhttp://www.blogger.com/profile/16951554565276475785noreply@blogger.comBlogger35125tag:blogger.com,1999:blog-2481837686846186453.post-30226248940880614502014-12-04T14:09:00.000-08:002014-12-04T14:09:01.358-08:00aaaaaannnnnd scene.Today I gave my presentation of research. The presentation went well, but I certainly wish I would have had just a few more weeks to work on this project. I feel that I was on the verge of actually being able to accomplish what I set out to do two semesters ago. Alas, that is not the case. It is my hope hope that someone within the S-STEM will pick up the torch that I have laid down. The body of work i have completed will be an excellent springboard for another scholar to launch towards successfully proving that my good friend the Palo Verde does actually reproduce through cloning. I have been dangling the carrot of what a good project this in front of everyone who will listen. I firmly believe that this work, when completed, IS publishable. How amazing would it be for an undergrad at the pre-associate level to have a published work?<br />
<br />
So, it is with sadness that I sit here at the computer composing my final blog post as a S-STEM scholar at Phoenix College. There are many people here that I will miss as I move on. The memories that I have made within my journey in this program will be with me always. I have gained some very good insight into who I am and what I am capable of through my experiences here. This program is by far more valuable to me in an educational sense than any other aspect of my scholastic career so far. If as my academic career continues, I can find a program that is half what this program is, I will consider myself extremely lucky!<br />
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjRPEL06c4HsSUCfH4HsuvvdNOD1EuXPAj9PPcVHLif_PBpemDFGdzsQ7GDv4qTfMv1QZmHW2ACsA8gUoGfUGbDFPsBWAXmlzIku4sgY4fHtcKFI-xnfVwpNllKu-WSEOcZTXzoxJhU75I/s1600/4f15ca326d661fd71177bcd909ec6023cc4b1688aee152ebb815e15a8fc380f8.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjRPEL06c4HsSUCfH4HsuvvdNOD1EuXPAj9PPcVHLif_PBpemDFGdzsQ7GDv4qTfMv1QZmHW2ACsA8gUoGfUGbDFPsBWAXmlzIku4sgY4fHtcKFI-xnfVwpNllKu-WSEOcZTXzoxJhU75I/s1600/4f15ca326d661fd71177bcd909ec6023cc4b1688aee152ebb815e15a8fc380f8.jpg" height="298" width="400" /></a></div>
<div class="separator" style="clear: both; text-align: center;">
and tastee oh's :)</div>
<br />Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com0tag:blogger.com,1999:blog-2481837686846186453.post-28678237451182137712014-11-26T12:19:00.000-08:002014-12-02T08:10:15.301-08:00EUREKA!!! (almost)<!--[if !mso]>
<style>
v\:* {behavior:url(#default#VML);}
o\:* {behavior:url(#default#VML);}
w\:* {behavior:url(#default#VML);}
.shape {behavior:url(#default#VML);}
</style>
<![endif]--><!--[if gte mso 9]><xml>
<o:OfficeDocumentSettings>
<o:AllowPNG/>
</o:OfficeDocumentSettings>
</xml><![endif]-->
<!--[if gte mso 9]><xml>
<w:WordDocument>
<w:View>Normal</w:View>
<w:Zoom>0</w:Zoom>
<w:TrackMoves>false</w:TrackMoves>
<w:TrackFormatting/>
<w:PunctuationKerning/>
<w:ValidateAgainstSchemas/>
<w:SaveIfXMLInvalid>false</w:SaveIfXMLInvalid>
<w:IgnoreMixedContent>false</w:IgnoreMixedContent>
<w:AlwaysShowPlaceholderText>false</w:AlwaysShowPlaceholderText>
<w:DoNotPromoteQF/>
<w:LidThemeOther>EN-US</w:LidThemeOther>
<w:LidThemeAsian>JA</w:LidThemeAsian>
<w:LidThemeComplexScript>X-NONE</w:LidThemeComplexScript>
<w:Compatibility>
<w:BreakWrappedTables/>
<w:SnapToGridInCell/>
<w:WrapTextWithPunct/>
<w:UseAsianBreakRules/>
<w:DontGrowAutofit/>
<w:SplitPgBreakAndParaMark/>
<w:EnableOpenTypeKerning/>
<w:DontFlipMirrorIndents/>
<w:OverrideTableStyleHps/>
<w:UseFELayout/>
</w:Compatibility>
<m:mathPr>
<m:mathFont m:val="Cambria Math"/>
<m:brkBin m:val="before"/>
<m:brkBinSub m:val="--"/>
<m:smallFrac m:val="off"/>
<m:dispDef/>
<m:lMargin m:val="0"/>
<m:rMargin m:val="0"/>
<m:defJc m:val="centerGroup"/>
<m:wrapIndent m:val="1440"/>
<m:intLim m:val="subSup"/>
<m:naryLim m:val="undOvr"/>
</m:mathPr></w:WordDocument>
</xml><![endif]--><!--[if gte mso 9]><xml>
<w:LatentStyles DefLockedState="false" DefUnhideWhenUsed="true"
DefSemiHidden="true" DefQFormat="false" DefPriority="99"
LatentStyleCount="276">
<w:LsdException Locked="false" Priority="0" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Normal"/>
<w:LsdException Locked="false" Priority="9" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="heading 1"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 2"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 3"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 4"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 5"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 6"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 7"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 8"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 9"/>
<w:LsdException Locked="false" Priority="39" Name="toc 1"/>
<w:LsdException Locked="false" Priority="39" Name="toc 2"/>
<w:LsdException Locked="false" Priority="39" Name="toc 3"/>
<w:LsdException Locked="false" Priority="39" Name="toc 4"/>
<w:LsdException Locked="false" Priority="39" Name="toc 5"/>
<w:LsdException Locked="false" Priority="39" Name="toc 6"/>
<w:LsdException Locked="false" Priority="39" Name="toc 7"/>
<w:LsdException Locked="false" Priority="39" Name="toc 8"/>
<w:LsdException Locked="false" Priority="39" Name="toc 9"/>
<w:LsdException Locked="false" Priority="35" QFormat="true" Name="caption"/>
<w:LsdException Locked="false" Priority="10" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Title"/>
<w:LsdException Locked="false" Priority="1" Name="Default Paragraph Font"/>
<w:LsdException Locked="false" Priority="11" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtitle"/>
<w:LsdException Locked="false" Priority="22" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Strong"/>
<w:LsdException Locked="false" Priority="20" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Emphasis"/>
<w:LsdException Locked="false" Priority="59" SemiHidden="false"
UnhideWhenUsed="false" Name="Table Grid"/>
<w:LsdException Locked="false" UnhideWhenUsed="false" Name="Placeholder Text"/>
<w:LsdException Locked="false" Priority="1" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="No Spacing"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 1"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 1"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 1"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 1"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 1"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 1"/>
<w:LsdException Locked="false" UnhideWhenUsed="false" Name="Revision"/>
<w:LsdException Locked="false" Priority="34" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="List Paragraph"/>
<w:LsdException Locked="false" Priority="29" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Quote"/>
<w:LsdException Locked="false" Priority="30" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Quote"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 1"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 1"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 1"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 1"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 1"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 1"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 1"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 1"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 2"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 2"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 2"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 2"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 2"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 2"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 2"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 2"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 2"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 2"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 2"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 2"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 2"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 2"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 3"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 3"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 3"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 3"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 3"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 3"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 3"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 3"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 3"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 3"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 3"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 3"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 3"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 3"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 4"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 4"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 4"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 4"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 4"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 4"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 4"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 4"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 4"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 4"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 4"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 4"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 4"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 4"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 5"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 5"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 5"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 5"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 5"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 5"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 5"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 5"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 5"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 5"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 5"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 5"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 5"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 5"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 6"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 6"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 6"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 6"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 6"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 6"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 6"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 6"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 6"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 6"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 6"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 6"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 6"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 6"/>
<w:LsdException Locked="false" Priority="19" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtle Emphasis"/>
<w:LsdException Locked="false" Priority="21" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Emphasis"/>
<w:LsdException Locked="false" Priority="31" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtle Reference"/>
<w:LsdException Locked="false" Priority="32" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Reference"/>
<w:LsdException Locked="false" Priority="33" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Book Title"/>
<w:LsdException Locked="false" Priority="37" Name="Bibliography"/>
<w:LsdException Locked="false" Priority="39" QFormat="true" Name="TOC Heading"/>
</w:LatentStyles>
</xml><![endif]-->
<!--[if gte mso 10]>
<style>
/* Style Definitions */
table.MsoNormalTable
{mso-style-name:"Table Normal";
mso-tstyle-rowband-size:0;
mso-tstyle-colband-size:0;
mso-style-noshow:yes;
mso-style-priority:99;
mso-style-parent:"";
mso-padding-alt:0in 5.4pt 0in 5.4pt;
mso-para-margin:0in;
mso-para-margin-bottom:.0001pt;
mso-pagination:widow-orphan;
font-size:12.0pt;
font-family:"Times New Roman";}
</style>
<![endif]-->
<!--StartFragment-->
<br />
<div class="MsoNormal">
The PCR process was successful! Well, sort of… As is
seemingly the norm for me, my results introduced some new questions. I’ll get
to that in a moment. First and foremost, when electrophoresis was conducted
using my PCR results, there were evident bands of DNA that traveled in the gel.
This means that even though there was sheering evident in my extraction method,
there was a viable product that yielded suitable fragments of DNA that could be
amplified through PCR. <o:p></o:p></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
The chloroplast primers I used were not suitable for
purposes of differentiating between the individual test subjects of my
research. These primers are very general in nature and were just used to see if
the extraction results contained amplifiable DNA. This is the Eureka part. The
new questions arise from where the bands occurred on the gels.<o:p></o:p></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
PCR was conducted with the results from three different
extractions: the 1<sup>st</sup> was the extraction that appeared to have a
massive amount of DNA with heavy shearing, the 2<sup>nd</sup> was the same protocol
but done in a linear manner (in the 1<sup>st</sup> the protocol the run was
broken up due to time constraints, and this may have caused shearing), and the
3<sup>rd</sup> was the same as 2<sup>nd</sup> run, with the addition of using
improvised wide bore pipette tips (again to try to reduce shearing). Each
sample went through PCR using 3 different concentrations of each extraction for
a total of 9 PCR reactions. The banding appeared in the wells containing the 1μL
and 2μL extraction concentrations. There was no banding/travel exhibited in the
3μL concentrations. To relay a clearer version of what I observed in the 3
gels, I reran in a new gel omitting the 3μL concentrations. Below is the image
of that gel.<o:p></o:p></div>
<div class="MsoNormal">
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh-sGASCGQrOKHVU4lB2NSM7Q0BgGj5M6hHNe2WNRbQX2rs9nt_CfgFAHxElrFC2CbYWb3Dzi7KZR4fMr8Eqq76yNn-EdlPeCZtcO2g-ynE5jT1o5VOYphLsSriI_MOQVGXCxbjB_iErhs/s1600/final+gel.png" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh-sGASCGQrOKHVU4lB2NSM7Q0BgGj5M6hHNe2WNRbQX2rs9nt_CfgFAHxElrFC2CbYWb3Dzi7KZR4fMr8Eqq76yNn-EdlPeCZtcO2g-ynE5jT1o5VOYphLsSriI_MOQVGXCxbjB_iErhs/s1600/final+gel.png" height="300" width="400" /></a></div>
<br />
<br />
As wonderful as it was to observe a discernable band of PCR
results travel in a gel, my elation was cut when I noticed where the travel
occurred. Evident bands appeared in two different extractions at two different
concentrations! Even though I was extremely meticulous in labeling, handling
and loading the samples, it is my hope that I mislabeled or misloaded one of
the samples. I cannot come up with a viable explanation for these results – it just
does not make any sense.</div>
<div class="MsoNormal">
<o:p></o:p></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
It appears as though next week I will give it another run…<o:p></o:p></div>
<!--EndFragment-->Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com0tag:blogger.com,1999:blog-2481837686846186453.post-12097338107194085172014-11-20T15:17:00.000-08:002014-11-20T15:20:46.506-08:00PCR ASAPWell, as I feared, the "no grind" extraction was fruitless. The "wide bore" extraction was unfortunately not a resounding success either. There was DNA, but it appeared to be sheared (again). Another interesting point to note, is the distance the samples traveled through the gel. As far as my understanding goes (and from many, many conversations with people more in the know than I), genomic DNA typically does not travel as far as it did in my gels. Genomic DNA is relatively large and therefore should not migrate very far in the gel at all. Could the additional observed travel be a result of shearing making the molecules smaller and therefore easier for them to travel in the gel?<br />
<br />
As the time crunch is officially upon us, I have decided to see if, within the potentially sheared DNA samples, there is something the chloroplast primers can identify and reproduce. It is sort of a Hail Mary at the end of the semester in order to see if I can get some form of PCR results to use in comparison of the individual subjects.<br />
<div style="text-align: left;">
<span style="font-family: inherit;"><br /></span></div>
<div style="text-align: left;">
<span style="font-family: inherit;">For PCR, I mixed 550µL of master mix with 11µL of chloroplast primer to create a stock solution. 20µL of this stock solution was added to each PCR tube. Then, I added a combination of DNA extraction sample and Ultra Pure H<sub>2</sub>O totaling 20µL. For each of the three DNA extractions I conducted 3 PCR reactions: tube one held 1µL of sample, and 19µL of Ultra Pure H<sub>2</sub>O; tube 2, 2µL of sample, and 19µL of Ultra Pure H<sub>2</sub>O; tube 3, 3µL sample, and 17µL of Ultra Pure H<sub>2</sub>O. The protocol or pattern for the PCR cycle is as follows:</span></div>
<br />
<ol>
<li>Initial Denaturation: 94°C for 2 minutes</li>
<li>Denaturation: 94°C for 1 minute</li>
<li>Annealing: 59°C for 1 minute</li>
<li>Extension: 72°C for 2 minute</li>
<li>Steps 2-4 repeated 40 times</li>
<li>Final Extension: 72°C for 10 minutes</li>
<li>Hold: 4°C indefinitely</li>
</ol>
Tomorrow I will cross my fingers and run another gel with the PCR results. Here's for hoping!<br />
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhpIAXvwPsXu9EmitxpUHd4zwQu-mCFIkR1hMhjj2k-SsazqWhIOaJVXwcGw4zvsIytPI7wziPczT05knhSGkwUCj3mKVUHRx66P7B66XowU8UVTXGpeNTIN7NWHQU7yjzoaARv712VpPw/s1600/photo.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhpIAXvwPsXu9EmitxpUHd4zwQu-mCFIkR1hMhjj2k-SsazqWhIOaJVXwcGw4zvsIytPI7wziPczT05knhSGkwUCj3mKVUHRx66P7B66XowU8UVTXGpeNTIN7NWHQU7yjzoaARv712VpPw/s1600/photo.JPG" height="239" width="320" /></a></div>
<div class="separator" style="clear: both; text-align: center;">
Preparing the samples for PCR.</div>
<div class="MsoNormal">
<o:p></o:p></div>
<div class="MsoNormal">
<o:p></o:p></div>
<div class="MsoNormal">
<o:p></o:p></div>
<div class="MsoNormal">
<o:p></o:p></div>
<div class="MsoNormal">
<o:p></o:p></div>
<div class="MsoNormal">
<o:p></o:p></div>
<div class="MsoNormal">
<o:p></o:p></div>
Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com0tag:blogger.com,1999:blog-2481837686846186453.post-74226842772714845032014-11-13T14:26:00.001-08:002014-11-13T14:26:48.938-08:00FIELD TRIP!!!!Last Friday was the S-STEM field trip. We journeyed out to Dreamy Draw to take look into the ecology of ephemeral washes. Very familiar territory for me both literally and figuratively. The location was almost on the exact opposite side of Squaw Peak from my sample collection site, and my collection site also happens to be an ephemeral wash! The dry washes are a very interesting phenomenon ecologically speaking. As I am currently conducting research in a one of these washes, I have previously discussed much of the information that Matt relayed to us concerning them.<br />
<br />
We also did a fair amount of geocache hunting. I really enjoyed this it had been at least 5 years since I have done any geocaching, and I am wondering why I ever stopped. In addition to this, Josh and Jenni both planted a couple of geocaches. I had never done this previously. Good times! Josh placed his at a fork in the path and had a clever clue to it's location based, of course, in Star Wars. Jenni found a large hole that turned out to be what we think was an exploratory mine. This area was used in mining cinnabar (mercury).<br />
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgXYd-VzPP6W7zXKswS4I2q5jcP5cHAp8lNHboYuXZo5fAYc_7GA8rkcpRr-OLY_2Qa2ZTrMuRPA5_sAsN6LTlDugrViY7IlNnDgy4MkXHWdtKR_TqP__WWgGcus_odnvxuqNV1hxaCg-k/s1600/Jenni's%2Bhole.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" height="640" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgXYd-VzPP6W7zXKswS4I2q5jcP5cHAp8lNHboYuXZo5fAYc_7GA8rkcpRr-OLY_2Qa2ZTrMuRPA5_sAsN6LTlDugrViY7IlNnDgy4MkXHWdtKR_TqP__WWgGcus_odnvxuqNV1hxaCg-k/s640/Jenni's%2Bhole.JPG" width="476" /></a></div>
<div class="separator" style="clear: both; text-align: center;">
Matt, Josh, Andrew, and Jenni in Jenni's hole</div>
<div class="separator" style="clear: both; text-align: center;">
<br /></div>
<div class="separator" style="clear: both; text-align: left;">
As far as my lab work goes, This being a holiday, I don't have a lot to report. Monday's lab time was spent examining protocol for the sucrose based extraction. Today I conducted the PCI extraction on a fresh sample as well as the sample I soaked in the lysis buffer without grinding. Both of these instructions were completed using my makeshift wide bore pipette tips in an effort to reduce shearing. At the moment both sa,mples are held in a proscribed overnight freeze. Tomorrow, the extractions will be finished. As of now, the fresh extraction appears to be promising - I am seeing a precipitate (DNA) come out of solution. The other extraction, not so much. The solution is VERY clear - no signs of precipitate at all. Negative results are still results...</div>
<br />
<br />Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com0tag:blogger.com,1999:blog-2481837686846186453.post-15672828221563849042014-11-06T13:21:00.000-08:002014-11-06T13:21:39.622-08:00Still plugging along<!--[if gte mso 9]><xml>
<o:OfficeDocumentSettings>
<o:AllowPNG/>
</o:OfficeDocumentSettings>
</xml><![endif]-->
<!--[if gte mso 9]><xml>
<w:WordDocument>
<w:View>Normal</w:View>
<w:Zoom>0</w:Zoom>
<w:TrackMoves/>
<w:TrackFormatting/>
<w:PunctuationKerning/>
<w:ValidateAgainstSchemas/>
<w:SaveIfXMLInvalid>false</w:SaveIfXMLInvalid>
<w:IgnoreMixedContent>false</w:IgnoreMixedContent>
<w:AlwaysShowPlaceholderText>false</w:AlwaysShowPlaceholderText>
<w:DoNotPromoteQF/>
<w:LidThemeOther>EN-US</w:LidThemeOther>
<w:LidThemeAsian>JA</w:LidThemeAsian>
<w:LidThemeComplexScript>X-NONE</w:LidThemeComplexScript>
<w:Compatibility>
<w:BreakWrappedTables/>
<w:SnapToGridInCell/>
<w:WrapTextWithPunct/>
<w:UseAsianBreakRules/>
<w:DontGrowAutofit/>
<w:SplitPgBreakAndParaMark/>
<w:EnableOpenTypeKerning/>
<w:DontFlipMirrorIndents/>
<w:OverrideTableStyleHps/>
<w:UseFELayout/>
</w:Compatibility>
<m:mathPr>
<m:mathFont m:val="Cambria Math"/>
<m:brkBin m:val="before"/>
<m:brkBinSub m:val="--"/>
<m:smallFrac m:val="off"/>
<m:dispDef/>
<m:lMargin m:val="0"/>
<m:rMargin m:val="0"/>
<m:defJc m:val="centerGroup"/>
<m:wrapIndent m:val="1440"/>
<m:intLim m:val="subSup"/>
<m:naryLim m:val="undOvr"/>
</m:mathPr></w:WordDocument>
</xml><![endif]--><!--[if gte mso 9]><xml>
<w:LatentStyles DefLockedState="false" DefUnhideWhenUsed="true"
DefSemiHidden="true" DefQFormat="false" DefPriority="99"
LatentStyleCount="276">
<w:LsdException Locked="false" Priority="0" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Normal"/>
<w:LsdException Locked="false" Priority="9" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="heading 1"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 2"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 3"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 4"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 5"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 6"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 7"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 8"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 9"/>
<w:LsdException Locked="false" Priority="39" Name="toc 1"/>
<w:LsdException Locked="false" Priority="39" Name="toc 2"/>
<w:LsdException Locked="false" Priority="39" Name="toc 3"/>
<w:LsdException Locked="false" Priority="39" Name="toc 4"/>
<w:LsdException Locked="false" Priority="39" Name="toc 5"/>
<w:LsdException Locked="false" Priority="39" Name="toc 6"/>
<w:LsdException Locked="false" Priority="39" Name="toc 7"/>
<w:LsdException Locked="false" Priority="39" Name="toc 8"/>
<w:LsdException Locked="false" Priority="39" Name="toc 9"/>
<w:LsdException Locked="false" Priority="35" QFormat="true" Name="caption"/>
<w:LsdException Locked="false" Priority="10" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Title"/>
<w:LsdException Locked="false" Priority="1" Name="Default Paragraph Font"/>
<w:LsdException Locked="false" Priority="11" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtitle"/>
<w:LsdException Locked="false" Priority="22" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Strong"/>
<w:LsdException Locked="false" Priority="20" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Emphasis"/>
<w:LsdException Locked="false" Priority="59" SemiHidden="false"
UnhideWhenUsed="false" Name="Table Grid"/>
<w:LsdException Locked="false" UnhideWhenUsed="false" Name="Placeholder Text"/>
<w:LsdException Locked="false" Priority="1" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="No Spacing"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 1"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 1"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 1"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 1"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 1"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 1"/>
<w:LsdException Locked="false" UnhideWhenUsed="false" Name="Revision"/>
<w:LsdException Locked="false" Priority="34" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="List Paragraph"/>
<w:LsdException Locked="false" Priority="29" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Quote"/>
<w:LsdException Locked="false" Priority="30" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Quote"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 1"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 1"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 1"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 1"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 1"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 1"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 1"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 1"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 2"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 2"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 2"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 2"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 2"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 2"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 2"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 2"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 2"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 2"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 2"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 2"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 2"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 2"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 3"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 3"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 3"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 3"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 3"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 3"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 3"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 3"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 3"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 3"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 3"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 3"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 3"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 3"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 4"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 4"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 4"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 4"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 4"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 4"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 4"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 4"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 4"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 4"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 4"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 4"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 4"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 4"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 5"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 5"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 5"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 5"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 5"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 5"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 5"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 5"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 5"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 5"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 5"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 5"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 5"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 5"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 6"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 6"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 6"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 6"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 6"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 6"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 6"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 6"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 6"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 6"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 6"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 6"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 6"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 6"/>
<w:LsdException Locked="false" Priority="19" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtle Emphasis"/>
<w:LsdException Locked="false" Priority="21" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Emphasis"/>
<w:LsdException Locked="false" Priority="31" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtle Reference"/>
<w:LsdException Locked="false" Priority="32" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Reference"/>
<w:LsdException Locked="false" Priority="33" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Book Title"/>
<w:LsdException Locked="false" Priority="37" Name="Bibliography"/>
<w:LsdException Locked="false" Priority="39" QFormat="true" Name="TOC Heading"/>
</w:LatentStyles>
</xml><![endif]-->
<!--[if gte mso 10]>
<style>
/* Style Definitions */
table.MsoNormalTable
{mso-style-name:"Table Normal";
mso-tstyle-rowband-size:0;
mso-tstyle-colband-size:0;
mso-style-noshow:yes;
mso-style-priority:99;
mso-style-parent:"";
mso-padding-alt:0in 5.4pt 0in 5.4pt;
mso-para-margin:0in;
mso-para-margin-bottom:.0001pt;
mso-pagination:widow-orphan;
font-size:12.0pt;
font-family:"Times New Roman";}
</style>
<![endif]-->
<!--StartFragment-->
<br />
<div class="MsoNormal">
This week I conducted another run with the phenol chloroform
extraction. In this attempt, I halved the amount of initial plant tissue, and
worked to reduce the break points in the protocol. This being my second usage
of the protocol coupled with my conducting it on a day in which I had more
hours to devote to it, allowed me to conduct the protocol seamlessly with no
breaks other than incubation time. Unfortunately the results still exhibited
signs of shearing.<o:p></o:p></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiFUiiIhzhQgkP_F4gdxh84xKWo203mKmwUGnnLHtDDxMNzi2ML9Z5NhWkD3ugEjKNF5M8jrrv_WErcehiabgvnQopZy1zvESjj-3tNiDVgblHE-ayVc9j1BsU9kuWXlrud6-lr_hQum7Q/s1600/UVP00167.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiFUiiIhzhQgkP_F4gdxh84xKWo203mKmwUGnnLHtDDxMNzi2ML9Z5NhWkD3ugEjKNF5M8jrrv_WErcehiabgvnQopZy1zvESjj-3tNiDVgblHE-ayVc9j1BsU9kuWXlrud6-lr_hQum7Q/s1600/UVP00167.JPG" height="243" width="320" /></a></div>
<div class="separator" style="clear: both; text-align: center;">
This is a picture of the gel from the camera mounted on the UV light box. The beginings of banding can be seen, but the DNA sample is sheared (the lanes are just streaks)</div>
<br /></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
I am currently working on two other ideas that will
hopefully reduce the shearing. The first step of the protocol is to grind the
leaf tissue samples (-80° C) in the lysis buffer containing the 5% sarkosyl
solution and the 4% SDS solution, and then incubate it at 50° C for two hours.
It is my suspicion that shearing may be occurring in the grinding. I have taken
tissue samples and incubated them in the buffer for an extended period of time
without grinding. I am not sure if this will yield anything, but it does merit
testing. The other potential shearing point that I see is the pipetting of the
samples. I suspect that drawing the samples through the narrow tip of a
standard pipette could cause shearing. Since there are not any wide bore
pipettes available for use, I will snip the pipette tips back to a wider
opening for each pipetting. I had intended on this today, but unfortunately the
BIO 181 classes are using the fume hood today. Normally Tuesday and Thursday
are the days I have enough time in the lab to carry out the full extraction.
Next Tuesday is a holiday, so I will not be able to revisit this until Thursday.
Hopefully I will see a clean nicely banded lane in the well<o:p></o:p></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
As to the Sucrose extraction that Matt clued me in on – <o:p></o:p></div>
<div class="MsoNormal">
I have read that this is to induce an osmotic shock within
the cells as a means of cell lysis. The addition of the sucrose in the solution
increases the solute concentration outside of the cell. This rapid change of
concentration results in an equally rapid change in the movement of water
across the membranes (osmosis). The drastic change in pressures should lyse the
cell. If this is actually what happens, I should be able to use a sucrose lysis
buffer and not have to manually grind the tissues. This is in the same vein of
what I am doing with the current extraction – attempting to lyse cells with out
physical tissue homogenization. There was one protocol I read that specifically
stated that the sucrose buffer was very effective for plants that had been
previously shown to be difficult to extract DNA from. Unfortunately they didn’t
say why. I am still digging to see if I can find more information on this.<o:p></o:p></div>
<!--EndFragment-->Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com0tag:blogger.com,1999:blog-2481837686846186453.post-70878020604948331312014-10-30T09:25:00.002-07:002014-10-30T09:25:46.892-07:00First round in.I completed the DNA extraction protocol. On the positive side, I was able to extract a fairly large amount of DNA! On the negative side, the DNA appeared to be heavily sheared. There is a possibility that this still could generate good results with PCR, but I would rather see what I can do to reduce potential shearing points in my use of the protocol. I will also be re-evaluating the stop points I made in the protocol (for class and such), to see if I can smooth out the rather lengthy protocol and possibly eliminate points that are detrimental to the quality of the extraction.<br />
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiNoTb_sdm2P85HipkLkZELZizubhjtlBxuWLENzXkS00AXwT8jhAs9uFwvwyhGBx2gzwDrU37B7XpsnJ7b3Yus7dyZ7Ic2PsuCDyVxxOxh8jNEHXaHHWiUKm1_3hHdWX8GJhcGhb1SHzc/s1600/photo-7.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiNoTb_sdm2P85HipkLkZELZizubhjtlBxuWLENzXkS00AXwT8jhAs9uFwvwyhGBx2gzwDrU37B7XpsnJ7b3Yus7dyZ7Ic2PsuCDyVxxOxh8jNEHXaHHWiUKm1_3hHdWX8GJhcGhb1SHzc/s1600/photo-7.JPG" height="239" width="320" /></a></div>
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjNO_TMyUyGWobm2nWGZD912OqrhLmz4-B3udVtZZfvq1S1uvmzj8qZtC3T8sORaZSCSIjOGHASEfVLQJ5TzVzUV3kYkNbkcSC-Dj2eBmxy_n9rugmdGOyfAHUBK1QMYfmXg6d1pgYyQb4/s1600/photo-6.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjNO_TMyUyGWobm2nWGZD912OqrhLmz4-B3udVtZZfvq1S1uvmzj8qZtC3T8sORaZSCSIjOGHASEfVLQJ5TzVzUV3kYkNbkcSC-Dj2eBmxy_n9rugmdGOyfAHUBK1QMYfmXg6d1pgYyQb4/s1600/photo-6.JPG" height="239" width="320" /></a></div>
<div class="separator" style="clear: both; text-align: center;">
<br /></div>
<div class="separator" style="clear: both; text-align: left;">
In the above gels, you can see the faintest hint of banding. The smear is a result of DNA shearing. The lanes all contain 1μL of loading dye, and (from left to right) 2μL, 4μL, 6μL, and 8μL of the DNA extraction.</div>
<div class="separator" style="clear: both; text-align: left;">
<br /></div>
<div class="separator" style="clear: both; text-align: left;">
Next week I will conduct two different extractions for comparison to this protocol. One is similar to techniques I tried last semester. The other is one that I never heard of before. Matt Haberkorn came across it and told me about it. I need to do some research to find a good protocol for this extraction; it is evidently a sucrose based extraction. I will have more info on this in next weeks blog update.</div>
<!--[if gte mso 9]><xml>
<o:OfficeDocumentSettings>
<o:AllowPNG/>
</o:OfficeDocumentSettings>
</xml><![endif]-->
<!--[if gte mso 9]><xml>
<w:WordDocument>
<w:View>Normal</w:View>
<w:Zoom>0</w:Zoom>
<w:TrackMoves/>
<w:TrackFormatting/>
<w:PunctuationKerning/>
<w:ValidateAgainstSchemas/>
<w:SaveIfXMLInvalid>false</w:SaveIfXMLInvalid>
<w:IgnoreMixedContent>false</w:IgnoreMixedContent>
<w:AlwaysShowPlaceholderText>false</w:AlwaysShowPlaceholderText>
<w:DoNotPromoteQF/>
<w:LidThemeOther>EN-US</w:LidThemeOther>
<w:LidThemeAsian>JA</w:LidThemeAsian>
<w:LidThemeComplexScript>X-NONE</w:LidThemeComplexScript>
<w:Compatibility>
<w:BreakWrappedTables/>
<w:SnapToGridInCell/>
<w:WrapTextWithPunct/>
<w:UseAsianBreakRules/>
<w:DontGrowAutofit/>
<w:SplitPgBreakAndParaMark/>
<w:EnableOpenTypeKerning/>
<w:DontFlipMirrorIndents/>
<w:OverrideTableStyleHps/>
<w:UseFELayout/>
</w:Compatibility>
<m:mathPr>
<m:mathFont m:val="Cambria Math"/>
<m:brkBin m:val="before"/>
<m:brkBinSub m:val="--"/>
<m:smallFrac m:val="off"/>
<m:dispDef/>
<m:lMargin m:val="0"/>
<m:rMargin m:val="0"/>
<m:defJc m:val="centerGroup"/>
<m:wrapIndent m:val="1440"/>
<m:intLim m:val="subSup"/>
<m:naryLim m:val="undOvr"/>
</m:mathPr></w:WordDocument>
</xml><![endif]--><!--[if gte mso 9]><xml>
<w:LatentStyles DefLockedState="false" DefUnhideWhenUsed="true"
DefSemiHidden="true" DefQFormat="false" DefPriority="99"
LatentStyleCount="276">
<w:LsdException Locked="false" Priority="0" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Normal"/>
<w:LsdException Locked="false" Priority="9" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="heading 1"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 2"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 3"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 4"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 5"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 6"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 7"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 8"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 9"/>
<w:LsdException Locked="false" Priority="39" Name="toc 1"/>
<w:LsdException Locked="false" Priority="39" Name="toc 2"/>
<w:LsdException Locked="false" Priority="39" Name="toc 3"/>
<w:LsdException Locked="false" Priority="39" Name="toc 4"/>
<w:LsdException Locked="false" Priority="39" Name="toc 5"/>
<w:LsdException Locked="false" Priority="39" Name="toc 6"/>
<w:LsdException Locked="false" Priority="39" Name="toc 7"/>
<w:LsdException Locked="false" Priority="39" Name="toc 8"/>
<w:LsdException Locked="false" Priority="39" Name="toc 9"/>
<w:LsdException Locked="false" Priority="0" Name="header"/>
<w:LsdException Locked="false" Priority="35" QFormat="true" Name="caption"/>
<w:LsdException Locked="false" Priority="10" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Title"/>
<w:LsdException Locked="false" Priority="1" Name="Default Paragraph Font"/>
<w:LsdException Locked="false" Priority="11" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtitle"/>
<w:LsdException Locked="false" Priority="22" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Strong"/>
<w:LsdException Locked="false" Priority="20" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Emphasis"/>
<w:LsdException Locked="false" Priority="59" SemiHidden="false"
UnhideWhenUsed="false" Name="Table Grid"/>
<w:LsdException Locked="false" UnhideWhenUsed="false" Name="Placeholder Text"/>
<w:LsdException Locked="false" Priority="1" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="No Spacing"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 1"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 1"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 1"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 1"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 1"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 1"/>
<w:LsdException Locked="false" UnhideWhenUsed="false" Name="Revision"/>
<w:LsdException Locked="false" Priority="34" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="List Paragraph"/>
<w:LsdException Locked="false" Priority="29" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Quote"/>
<w:LsdException Locked="false" Priority="30" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Quote"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 1"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 1"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 1"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 1"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 1"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 1"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 1"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 1"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 2"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 2"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 2"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 2"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 2"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 2"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 2"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 2"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 2"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 2"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 2"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 2"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 2"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 2"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 3"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 3"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 3"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 3"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 3"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 3"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 3"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 3"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 3"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 3"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 3"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 3"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 3"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 3"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 4"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 4"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 4"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 4"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 4"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 4"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 4"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 4"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 4"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 4"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 4"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 4"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 4"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 4"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 5"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 5"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 5"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 5"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 5"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 5"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 5"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 5"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 5"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 5"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 5"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 5"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 5"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 5"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 6"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 6"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 6"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 6"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 6"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 6"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 6"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 6"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 6"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 6"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 6"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 6"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 6"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 6"/>
<w:LsdException Locked="false" Priority="19" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtle Emphasis"/>
<w:LsdException Locked="false" Priority="21" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Emphasis"/>
<w:LsdException Locked="false" Priority="31" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtle Reference"/>
<w:LsdException Locked="false" Priority="32" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Reference"/>
<w:LsdException Locked="false" Priority="33" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Book Title"/>
<w:LsdException Locked="false" Priority="37" Name="Bibliography"/>
<w:LsdException Locked="false" Priority="39" QFormat="true" Name="TOC Heading"/>
</w:LatentStyles>
</xml><![endif]-->
<!--[if gte mso 10]>
<style>
/* Style Definitions */
table.MsoNormalTable
{mso-style-name:"Table Normal";
mso-tstyle-rowband-size:0;
mso-tstyle-colband-size:0;
mso-style-noshow:yes;
mso-style-priority:99;
mso-style-parent:"";
mso-padding-alt:0in 5.4pt 0in 5.4pt;
mso-para-margin:0in;
mso-para-margin-bottom:.0001pt;
mso-pagination:widow-orphan;
font-size:12.0pt;
font-family:"Times New Roman";}
</style>
<![endif]-->
<!--StartFragment-->
<div class="MsoNormal">
<o:p></o:p></div>
<!--EndFragment-->
<!--[if gte mso 9]><xml>
<o:OfficeDocumentSettings>
<o:AllowPNG/>
</o:OfficeDocumentSettings>
</xml><![endif]-->
<!--[if gte mso 9]><xml>
<w:WordDocument>
<w:View>Normal</w:View>
<w:Zoom>0</w:Zoom>
<w:TrackMoves/>
<w:TrackFormatting/>
<w:PunctuationKerning/>
<w:ValidateAgainstSchemas/>
<w:SaveIfXMLInvalid>false</w:SaveIfXMLInvalid>
<w:IgnoreMixedContent>false</w:IgnoreMixedContent>
<w:AlwaysShowPlaceholderText>false</w:AlwaysShowPlaceholderText>
<w:DoNotPromoteQF/>
<w:LidThemeOther>EN-US</w:LidThemeOther>
<w:LidThemeAsian>JA</w:LidThemeAsian>
<w:LidThemeComplexScript>X-NONE</w:LidThemeComplexScript>
<w:Compatibility>
<w:BreakWrappedTables/>
<w:SnapToGridInCell/>
<w:WrapTextWithPunct/>
<w:UseAsianBreakRules/>
<w:DontGrowAutofit/>
<w:SplitPgBreakAndParaMark/>
<w:EnableOpenTypeKerning/>
<w:DontFlipMirrorIndents/>
<w:OverrideTableStyleHps/>
<w:UseFELayout/>
</w:Compatibility>
<m:mathPr>
<m:mathFont m:val="Cambria Math"/>
<m:brkBin m:val="before"/>
<m:brkBinSub m:val="--"/>
<m:smallFrac m:val="off"/>
<m:dispDef/>
<m:lMargin m:val="0"/>
<m:rMargin m:val="0"/>
<m:defJc m:val="centerGroup"/>
<m:wrapIndent m:val="1440"/>
<m:intLim m:val="subSup"/>
<m:naryLim m:val="undOvr"/>
</m:mathPr></w:WordDocument>
</xml><![endif]--><!--[if gte mso 9]><xml>
<w:LatentStyles DefLockedState="false" DefUnhideWhenUsed="true"
DefSemiHidden="true" DefQFormat="false" DefPriority="99"
LatentStyleCount="276">
<w:LsdException Locked="false" Priority="0" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Normal"/>
<w:LsdException Locked="false" Priority="9" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="heading 1"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 2"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 3"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 4"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 5"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 6"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 7"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 8"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 9"/>
<w:LsdException Locked="false" Priority="39" Name="toc 1"/>
<w:LsdException Locked="false" Priority="39" Name="toc 2"/>
<w:LsdException Locked="false" Priority="39" Name="toc 3"/>
<w:LsdException Locked="false" Priority="39" Name="toc 4"/>
<w:LsdException Locked="false" Priority="39" Name="toc 5"/>
<w:LsdException Locked="false" Priority="39" Name="toc 6"/>
<w:LsdException Locked="false" Priority="39" Name="toc 7"/>
<w:LsdException Locked="false" Priority="39" Name="toc 8"/>
<w:LsdException Locked="false" Priority="39" Name="toc 9"/>
<w:LsdException Locked="false" Priority="0" Name="header"/>
<w:LsdException Locked="false" Priority="35" QFormat="true" Name="caption"/>
<w:LsdException Locked="false" Priority="10" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Title"/>
<w:LsdException Locked="false" Priority="1" Name="Default Paragraph Font"/>
<w:LsdException Locked="false" Priority="11" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtitle"/>
<w:LsdException Locked="false" Priority="22" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Strong"/>
<w:LsdException Locked="false" Priority="20" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Emphasis"/>
<w:LsdException Locked="false" Priority="59" SemiHidden="false"
UnhideWhenUsed="false" Name="Table Grid"/>
<w:LsdException Locked="false" UnhideWhenUsed="false" Name="Placeholder Text"/>
<w:LsdException Locked="false" Priority="1" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="No Spacing"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 1"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 1"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 1"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 1"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 1"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 1"/>
<w:LsdException Locked="false" UnhideWhenUsed="false" Name="Revision"/>
<w:LsdException Locked="false" Priority="34" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="List Paragraph"/>
<w:LsdException Locked="false" Priority="29" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Quote"/>
<w:LsdException Locked="false" Priority="30" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Quote"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 1"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 1"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 1"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 1"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 1"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 1"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 1"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 1"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 2"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 2"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 2"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 2"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 2"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 2"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 2"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 2"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 2"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 2"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 2"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 2"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 2"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 2"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 3"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 3"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 3"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 3"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 3"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 3"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 3"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 3"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 3"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 3"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 3"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 3"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 3"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 3"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 4"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 4"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 4"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 4"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 4"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 4"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 4"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 4"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 4"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 4"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 4"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 4"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 4"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 4"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 5"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 5"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 5"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 5"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 5"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 5"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 5"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 5"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 5"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 5"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 5"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 5"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 5"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 5"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 6"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 6"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 6"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 6"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 6"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 6"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 6"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 6"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 6"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 6"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 6"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 6"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 6"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 6"/>
<w:LsdException Locked="false" Priority="19" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtle Emphasis"/>
<w:LsdException Locked="false" Priority="21" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Emphasis"/>
<w:LsdException Locked="false" Priority="31" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtle Reference"/>
<w:LsdException Locked="false" Priority="32" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Reference"/>
<w:LsdException Locked="false" Priority="33" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Book Title"/>
<w:LsdException Locked="false" Priority="37" Name="Bibliography"/>
<w:LsdException Locked="false" Priority="39" QFormat="true" Name="TOC Heading"/>
</w:LatentStyles>
</xml><![endif]-->
<!--[if gte mso 10]>
<style>
/* Style Definitions */
table.MsoNormalTable
{mso-style-name:"Table Normal";
mso-tstyle-rowband-size:0;
mso-tstyle-colband-size:0;
mso-style-noshow:yes;
mso-style-priority:99;
mso-style-parent:"";
mso-padding-alt:0in 5.4pt 0in 5.4pt;
mso-para-margin:0in;
mso-para-margin-bottom:.0001pt;
mso-pagination:widow-orphan;
font-size:12.0pt;
font-family:"Times New Roman";}
</style>
<![endif]-->
<!--StartFragment-->
<div class="MsoNormal">
<o:p></o:p></div>
<!--EndFragment-->
<!--[if gte mso 9]><xml>
<o:OfficeDocumentSettings>
<o:AllowPNG/>
</o:OfficeDocumentSettings>
</xml><![endif]-->
<!--[if gte mso 9]><xml>
<w:WordDocument>
<w:View>Normal</w:View>
<w:Zoom>0</w:Zoom>
<w:TrackMoves/>
<w:TrackFormatting/>
<w:PunctuationKerning/>
<w:ValidateAgainstSchemas/>
<w:SaveIfXMLInvalid>false</w:SaveIfXMLInvalid>
<w:IgnoreMixedContent>false</w:IgnoreMixedContent>
<w:AlwaysShowPlaceholderText>false</w:AlwaysShowPlaceholderText>
<w:DoNotPromoteQF/>
<w:LidThemeOther>EN-US</w:LidThemeOther>
<w:LidThemeAsian>JA</w:LidThemeAsian>
<w:LidThemeComplexScript>X-NONE</w:LidThemeComplexScript>
<w:Compatibility>
<w:BreakWrappedTables/>
<w:SnapToGridInCell/>
<w:WrapTextWithPunct/>
<w:UseAsianBreakRules/>
<w:DontGrowAutofit/>
<w:SplitPgBreakAndParaMark/>
<w:EnableOpenTypeKerning/>
<w:DontFlipMirrorIndents/>
<w:OverrideTableStyleHps/>
<w:UseFELayout/>
</w:Compatibility>
<m:mathPr>
<m:mathFont m:val="Cambria Math"/>
<m:brkBin m:val="before"/>
<m:brkBinSub m:val="--"/>
<m:smallFrac m:val="off"/>
<m:dispDef/>
<m:lMargin m:val="0"/>
<m:rMargin m:val="0"/>
<m:defJc m:val="centerGroup"/>
<m:wrapIndent m:val="1440"/>
<m:intLim m:val="subSup"/>
<m:naryLim m:val="undOvr"/>
</m:mathPr></w:WordDocument>
</xml><![endif]--><!--[if gte mso 9]><xml>
<w:LatentStyles DefLockedState="false" DefUnhideWhenUsed="true"
DefSemiHidden="true" DefQFormat="false" DefPriority="99"
LatentStyleCount="276">
<w:LsdException Locked="false" Priority="0" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Normal"/>
<w:LsdException Locked="false" Priority="9" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="heading 1"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 2"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 3"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 4"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 5"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 6"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 7"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 8"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 9"/>
<w:LsdException Locked="false" Priority="39" Name="toc 1"/>
<w:LsdException Locked="false" Priority="39" Name="toc 2"/>
<w:LsdException Locked="false" Priority="39" Name="toc 3"/>
<w:LsdException Locked="false" Priority="39" Name="toc 4"/>
<w:LsdException Locked="false" Priority="39" Name="toc 5"/>
<w:LsdException Locked="false" Priority="39" Name="toc 6"/>
<w:LsdException Locked="false" Priority="39" Name="toc 7"/>
<w:LsdException Locked="false" Priority="39" Name="toc 8"/>
<w:LsdException Locked="false" Priority="39" Name="toc 9"/>
<w:LsdException Locked="false" Priority="0" Name="header"/>
<w:LsdException Locked="false" Priority="35" QFormat="true" Name="caption"/>
<w:LsdException Locked="false" Priority="10" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Title"/>
<w:LsdException Locked="false" Priority="1" Name="Default Paragraph Font"/>
<w:LsdException Locked="false" Priority="11" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtitle"/>
<w:LsdException Locked="false" Priority="22" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Strong"/>
<w:LsdException Locked="false" Priority="20" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Emphasis"/>
<w:LsdException Locked="false" Priority="59" SemiHidden="false"
UnhideWhenUsed="false" Name="Table Grid"/>
<w:LsdException Locked="false" UnhideWhenUsed="false" Name="Placeholder Text"/>
<w:LsdException Locked="false" Priority="1" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="No Spacing"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 1"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 1"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 1"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 1"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 1"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 1"/>
<w:LsdException Locked="false" UnhideWhenUsed="false" Name="Revision"/>
<w:LsdException Locked="false" Priority="34" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="List Paragraph"/>
<w:LsdException Locked="false" Priority="29" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Quote"/>
<w:LsdException Locked="false" Priority="30" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Quote"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 1"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 1"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 1"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 1"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 1"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 1"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 1"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 1"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 2"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 2"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 2"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 2"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 2"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 2"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 2"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 2"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 2"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 2"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 2"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 2"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 2"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 2"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 3"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 3"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 3"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 3"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 3"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 3"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 3"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 3"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 3"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 3"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 3"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 3"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 3"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 3"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 4"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 4"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 4"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 4"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 4"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 4"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 4"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 4"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 4"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 4"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 4"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 4"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 4"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 4"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 5"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 5"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 5"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 5"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 5"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 5"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 5"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 5"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 5"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 5"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 5"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 5"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 5"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 5"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 6"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 6"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 6"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 6"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 6"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 6"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 6"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 6"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 6"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 6"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 6"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 6"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 6"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 6"/>
<w:LsdException Locked="false" Priority="19" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtle Emphasis"/>
<w:LsdException Locked="false" Priority="21" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Emphasis"/>
<w:LsdException Locked="false" Priority="31" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtle Reference"/>
<w:LsdException Locked="false" Priority="32" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Reference"/>
<w:LsdException Locked="false" Priority="33" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Book Title"/>
<w:LsdException Locked="false" Priority="37" Name="Bibliography"/>
<w:LsdException Locked="false" Priority="39" QFormat="true" Name="TOC Heading"/>
</w:LatentStyles>
</xml><![endif]-->
<!--[if gte mso 10]>
<style>
/* Style Definitions */
table.MsoNormalTable
{mso-style-name:"Table Normal";
mso-tstyle-rowband-size:0;
mso-tstyle-colband-size:0;
mso-style-noshow:yes;
mso-style-priority:99;
mso-style-parent:"";
mso-padding-alt:0in 5.4pt 0in 5.4pt;
mso-para-margin:0in;
mso-para-margin-bottom:.0001pt;
mso-pagination:widow-orphan;
font-size:12.0pt;
font-family:"Times New Roman";}
</style>
<![endif]-->
<!--StartFragment-->
<div class="MsoNormal">
<o:p></o:p></div>
<!--EndFragment-->
<!--[if gte mso 9]><xml>
<o:OfficeDocumentSettings>
<o:AllowPNG/>
</o:OfficeDocumentSettings>
</xml><![endif]-->
<!--[if gte mso 9]><xml>
<w:WordDocument>
<w:View>Normal</w:View>
<w:Zoom>0</w:Zoom>
<w:TrackMoves/>
<w:TrackFormatting/>
<w:PunctuationKerning/>
<w:ValidateAgainstSchemas/>
<w:SaveIfXMLInvalid>false</w:SaveIfXMLInvalid>
<w:IgnoreMixedContent>false</w:IgnoreMixedContent>
<w:AlwaysShowPlaceholderText>false</w:AlwaysShowPlaceholderText>
<w:DoNotPromoteQF/>
<w:LidThemeOther>EN-US</w:LidThemeOther>
<w:LidThemeAsian>JA</w:LidThemeAsian>
<w:LidThemeComplexScript>X-NONE</w:LidThemeComplexScript>
<w:Compatibility>
<w:BreakWrappedTables/>
<w:SnapToGridInCell/>
<w:WrapTextWithPunct/>
<w:UseAsianBreakRules/>
<w:DontGrowAutofit/>
<w:SplitPgBreakAndParaMark/>
<w:EnableOpenTypeKerning/>
<w:DontFlipMirrorIndents/>
<w:OverrideTableStyleHps/>
<w:UseFELayout/>
</w:Compatibility>
<m:mathPr>
<m:mathFont m:val="Cambria Math"/>
<m:brkBin m:val="before"/>
<m:brkBinSub m:val="--"/>
<m:smallFrac m:val="off"/>
<m:dispDef/>
<m:lMargin m:val="0"/>
<m:rMargin m:val="0"/>
<m:defJc m:val="centerGroup"/>
<m:wrapIndent m:val="1440"/>
<m:intLim m:val="subSup"/>
<m:naryLim m:val="undOvr"/>
</m:mathPr></w:WordDocument>
</xml><![endif]--><!--[if gte mso 9]><xml>
<w:LatentStyles DefLockedState="false" DefUnhideWhenUsed="true"
DefSemiHidden="true" DefQFormat="false" DefPriority="99"
LatentStyleCount="276">
<w:LsdException Locked="false" Priority="0" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Normal"/>
<w:LsdException Locked="false" Priority="9" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="heading 1"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 2"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 3"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 4"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 5"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 6"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 7"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 8"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 9"/>
<w:LsdException Locked="false" Priority="39" Name="toc 1"/>
<w:LsdException Locked="false" Priority="39" Name="toc 2"/>
<w:LsdException Locked="false" Priority="39" Name="toc 3"/>
<w:LsdException Locked="false" Priority="39" Name="toc 4"/>
<w:LsdException Locked="false" Priority="39" Name="toc 5"/>
<w:LsdException Locked="false" Priority="39" Name="toc 6"/>
<w:LsdException Locked="false" Priority="39" Name="toc 7"/>
<w:LsdException Locked="false" Priority="39" Name="toc 8"/>
<w:LsdException Locked="false" Priority="39" Name="toc 9"/>
<w:LsdException Locked="false" Priority="0" Name="header"/>
<w:LsdException Locked="false" Priority="35" QFormat="true" Name="caption"/>
<w:LsdException Locked="false" Priority="10" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Title"/>
<w:LsdException Locked="false" Priority="1" Name="Default Paragraph Font"/>
<w:LsdException Locked="false" Priority="11" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtitle"/>
<w:LsdException Locked="false" Priority="22" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Strong"/>
<w:LsdException Locked="false" Priority="20" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Emphasis"/>
<w:LsdException Locked="false" Priority="59" SemiHidden="false"
UnhideWhenUsed="false" Name="Table Grid"/>
<w:LsdException Locked="false" UnhideWhenUsed="false" Name="Placeholder Text"/>
<w:LsdException Locked="false" Priority="1" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="No Spacing"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 1"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 1"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 1"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 1"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 1"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 1"/>
<w:LsdException Locked="false" UnhideWhenUsed="false" Name="Revision"/>
<w:LsdException Locked="false" Priority="34" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="List Paragraph"/>
<w:LsdException Locked="false" Priority="29" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Quote"/>
<w:LsdException Locked="false" Priority="30" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Quote"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 1"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 1"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 1"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 1"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 1"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 1"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 1"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 1"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 2"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 2"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 2"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 2"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 2"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 2"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 2"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 2"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 2"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 2"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 2"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 2"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 2"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 2"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 3"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 3"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 3"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 3"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 3"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 3"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 3"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 3"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 3"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 3"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 3"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 3"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 3"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 3"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 4"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 4"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 4"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 4"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 4"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 4"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 4"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 4"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 4"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 4"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 4"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 4"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 4"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 4"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 5"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 5"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 5"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 5"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 5"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 5"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 5"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 5"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 5"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 5"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 5"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 5"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 5"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 5"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 6"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 6"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 6"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 6"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 6"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 6"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 6"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 6"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 6"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 6"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 6"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 6"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 6"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 6"/>
<w:LsdException Locked="false" Priority="19" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtle Emphasis"/>
<w:LsdException Locked="false" Priority="21" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Emphasis"/>
<w:LsdException Locked="false" Priority="31" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtle Reference"/>
<w:LsdException Locked="false" Priority="32" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Reference"/>
<w:LsdException Locked="false" Priority="33" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Book Title"/>
<w:LsdException Locked="false" Priority="37" Name="Bibliography"/>
<w:LsdException Locked="false" Priority="39" QFormat="true" Name="TOC Heading"/>
</w:LatentStyles>
</xml><![endif]-->
<!--[if gte mso 10]>
<style>
/* Style Definitions */
table.MsoNormalTable
{mso-style-name:"Table Normal";
mso-tstyle-rowband-size:0;
mso-tstyle-colband-size:0;
mso-style-noshow:yes;
mso-style-priority:99;
mso-style-parent:"";
mso-padding-alt:0in 5.4pt 0in 5.4pt;
mso-para-margin:0in;
mso-para-margin-bottom:.0001pt;
mso-pagination:widow-orphan;
font-size:12.0pt;
font-family:"Times New Roman";}
</style>
<![endif]-->
<!--StartFragment-->
<div class="MsoNormal">
<o:p></o:p></div>
<!--EndFragment-->
<!--[if gte mso 9]><xml>
<o:OfficeDocumentSettings>
<o:AllowPNG/>
</o:OfficeDocumentSettings>
</xml><![endif]-->
<!--[if gte mso 9]><xml>
<w:WordDocument>
<w:View>Normal</w:View>
<w:Zoom>0</w:Zoom>
<w:TrackMoves/>
<w:TrackFormatting/>
<w:PunctuationKerning/>
<w:ValidateAgainstSchemas/>
<w:SaveIfXMLInvalid>false</w:SaveIfXMLInvalid>
<w:IgnoreMixedContent>false</w:IgnoreMixedContent>
<w:AlwaysShowPlaceholderText>false</w:AlwaysShowPlaceholderText>
<w:DoNotPromoteQF/>
<w:LidThemeOther>EN-US</w:LidThemeOther>
<w:LidThemeAsian>JA</w:LidThemeAsian>
<w:LidThemeComplexScript>X-NONE</w:LidThemeComplexScript>
<w:Compatibility>
<w:BreakWrappedTables/>
<w:SnapToGridInCell/>
<w:WrapTextWithPunct/>
<w:UseAsianBreakRules/>
<w:DontGrowAutofit/>
<w:SplitPgBreakAndParaMark/>
<w:EnableOpenTypeKerning/>
<w:DontFlipMirrorIndents/>
<w:OverrideTableStyleHps/>
<w:UseFELayout/>
</w:Compatibility>
<m:mathPr>
<m:mathFont m:val="Cambria Math"/>
<m:brkBin m:val="before"/>
<m:brkBinSub m:val="--"/>
<m:smallFrac m:val="off"/>
<m:dispDef/>
<m:lMargin m:val="0"/>
<m:rMargin m:val="0"/>
<m:defJc m:val="centerGroup"/>
<m:wrapIndent m:val="1440"/>
<m:intLim m:val="subSup"/>
<m:naryLim m:val="undOvr"/>
</m:mathPr></w:WordDocument>
</xml><![endif]--><!--[if gte mso 9]><xml>
<w:LatentStyles DefLockedState="false" DefUnhideWhenUsed="true"
DefSemiHidden="true" DefQFormat="false" DefPriority="99"
LatentStyleCount="276">
<w:LsdException Locked="false" Priority="0" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Normal"/>
<w:LsdException Locked="false" Priority="9" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="heading 1"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 2"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 3"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 4"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 5"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 6"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 7"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 8"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 9"/>
<w:LsdException Locked="false" Priority="39" Name="toc 1"/>
<w:LsdException Locked="false" Priority="39" Name="toc 2"/>
<w:LsdException Locked="false" Priority="39" Name="toc 3"/>
<w:LsdException Locked="false" Priority="39" Name="toc 4"/>
<w:LsdException Locked="false" Priority="39" Name="toc 5"/>
<w:LsdException Locked="false" Priority="39" Name="toc 6"/>
<w:LsdException Locked="false" Priority="39" Name="toc 7"/>
<w:LsdException Locked="false" Priority="39" Name="toc 8"/>
<w:LsdException Locked="false" Priority="39" Name="toc 9"/>
<w:LsdException Locked="false" Priority="0" Name="header"/>
<w:LsdException Locked="false" Priority="35" QFormat="true" Name="caption"/>
<w:LsdException Locked="false" Priority="10" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Title"/>
<w:LsdException Locked="false" Priority="1" Name="Default Paragraph Font"/>
<w:LsdException Locked="false" Priority="11" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtitle"/>
<w:LsdException Locked="false" Priority="22" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Strong"/>
<w:LsdException Locked="false" Priority="20" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Emphasis"/>
<w:LsdException Locked="false" Priority="59" SemiHidden="false"
UnhideWhenUsed="false" Name="Table Grid"/>
<w:LsdException Locked="false" UnhideWhenUsed="false" Name="Placeholder Text"/>
<w:LsdException Locked="false" Priority="1" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="No Spacing"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 1"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 1"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 1"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 1"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 1"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 1"/>
<w:LsdException Locked="false" UnhideWhenUsed="false" Name="Revision"/>
<w:LsdException Locked="false" Priority="34" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="List Paragraph"/>
<w:LsdException Locked="false" Priority="29" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Quote"/>
<w:LsdException Locked="false" Priority="30" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Quote"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 1"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 1"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 1"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 1"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 1"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 1"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 1"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 1"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 2"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 2"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 2"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 2"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 2"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 2"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 2"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 2"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 2"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 2"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 2"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 2"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 2"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 2"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 3"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 3"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 3"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 3"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 3"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 3"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 3"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 3"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 3"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 3"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 3"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 3"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 3"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 3"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 4"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 4"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 4"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 4"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 4"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 4"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 4"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 4"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 4"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 4"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 4"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 4"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 4"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 4"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 5"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 5"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 5"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 5"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 5"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 5"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 5"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 5"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 5"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 5"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 5"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 5"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 5"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 5"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 6"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 6"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 6"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 6"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 6"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 6"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 6"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 6"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 6"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 6"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 6"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 6"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 6"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 6"/>
<w:LsdException Locked="false" Priority="19" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtle Emphasis"/>
<w:LsdException Locked="false" Priority="21" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Emphasis"/>
<w:LsdException Locked="false" Priority="31" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtle Reference"/>
<w:LsdException Locked="false" Priority="32" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Reference"/>
<w:LsdException Locked="false" Priority="33" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Book Title"/>
<w:LsdException Locked="false" Priority="37" Name="Bibliography"/>
<w:LsdException Locked="false" Priority="39" QFormat="true" Name="TOC Heading"/>
</w:LatentStyles>
</xml><![endif]-->
<!--[if gte mso 10]>
<style>
/* Style Definitions */
table.MsoNormalTable
{mso-style-name:"Table Normal";
mso-tstyle-rowband-size:0;
mso-tstyle-colband-size:0;
mso-style-noshow:yes;
mso-style-priority:99;
mso-style-parent:"";
mso-padding-alt:0in 5.4pt 0in 5.4pt;
mso-para-margin:0in;
mso-para-margin-bottom:.0001pt;
mso-pagination:widow-orphan;
font-size:12.0pt;
font-family:"Times New Roman";}
</style>
<![endif]-->
<!--StartFragment-->
<div class="MsoNormal">
<o:p></o:p></div>
<!--EndFragment-->Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com0tag:blogger.com,1999:blog-2481837686846186453.post-535969079885840262014-10-23T14:46:00.000-07:002014-10-23T14:46:55.678-07:00Fingers crossedThis week I began working within my extraction protocol (finally). The protocol I am using is rather lengthy and this can be an issue for me as I only have certain time blocks for lab work. When scheduling my classes for this semester I tried very hard to work a non-class day into my schedule. This would have been amazing for research purposes - I would have been able to conduct this protocol all at once. Instead I have to compartmentalize the protocol. In order to be able to leave the lab lab for this semester's coursework, I have to find break points in the operation where the sample is (hopefully) stable enough to be stored until I return.<br />
<br />
I have not fully completed the extraction as yet. I have precipitated the DNA out of solution and things look very promising at this point. There are still a few more steps for washing the sample and then storing it in a TE buffer.<br />
<br />
Once this process is complete, I will likely run the sample through a spectrophotometer to obtain analytical data concerning concentration of DNA (thanks to Paul C. for his work on optimizing it's usage). Next will be the final tests of gel electrophoresis, and PCR.<br />
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjxOMPm-IkIJD89pS76jZRKLLsoVg737Lcv4Ra8iXaShSd0GseHg3nBNWsYGxckFlFg8TVtYwUtvf01bv5QSOyw_G4rRJcsyoeWd5Ix1vh9faAfoC9A02trJIVx7nDJ-MmnfnsA51TaZtc/s1600/DNA+precipitation.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjxOMPm-IkIJD89pS76jZRKLLsoVg737Lcv4Ra8iXaShSd0GseHg3nBNWsYGxckFlFg8TVtYwUtvf01bv5QSOyw_G4rRJcsyoeWd5Ix1vh9faAfoC9A02trJIVx7nDJ-MmnfnsA51TaZtc/s1600/DNA+precipitation.JPG" height="320" width="239" /></a></div>
<div class="separator" style="clear: both; text-align: center;">
<br /></div>
<div class="separator" style="clear: both; text-align: left;">
This is a 2mL eppendorf tube containing my DNA sample. The darker yellow substance in the bottom of the tube is the DNA. My fingers are crossed in hopes that this sample will be nice and clean for purposes of electrophoresis and PCR amplification.</div>
Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com0tag:blogger.com,1999:blog-2481837686846186453.post-32940387797352007872014-10-16T12:44:00.000-07:002014-10-16T12:47:53.912-07:00...This week has found me still in a holding pattern due to the lack of the appropriate pH phenol. The good news is, it has arrived!<br />
<br />
Through the week, I did a little research on Oak Ridge tubes for centrifugation of my samples. The tubes must be rated to withstand the action of the phenol chloroform solution. Not everything is up to the task of this. In the lab I found Oak Ridge tubes that were labeled PPCO and needed to find out if they would be appropriate. As it turns out, they are. PPCO refers to one of the constituent compounds of the tube: Polypropylene Copolymer. This is the stuff that is resilient enough to handle the phenol.<br />
<br />
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh4QZoxh8DVs_EbX1x6kKzEp_sH9BQIEe2rOKMolRvBl624D1GVIJ3BNYs2a0QOQnHH8-_7aU_hXsmJWflzpSAnHajA_9IT2bev_DfgUk3VxqeooJ5S6Y0KygolKsmzQ4ilFXWawP3JVLY/s1600/Screen+Shot+2014-10-16+at+12.35.04+PM.png" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh4QZoxh8DVs_EbX1x6kKzEp_sH9BQIEe2rOKMolRvBl624D1GVIJ3BNYs2a0QOQnHH8-_7aU_hXsmJWflzpSAnHajA_9IT2bev_DfgUk3VxqeooJ5S6Y0KygolKsmzQ4ilFXWawP3JVLY/s1600/Screen+Shot+2014-10-16+at+12.35.04+PM.png" height="126" width="400" /></a></div>
<div class="separator" style="clear: both; text-align: center;">
This is a screen shot from a pdf of Nalgene's catalogue </div>
<div class="separator" style="clear: both; text-align: center;">
available at <a href="http://www.catalogus.de/pdf/30/centrifugecatintl.pdf">http://www.catalogus.de/pdf/30/centrifugecatintl.pdf</a></div>
<div class="separator" style="clear: both; text-align: center;">
<br /></div>
<div class="separator" style="clear: both; text-align: left;">
Also, I noted that the SDS component solution for my lysis buffer had settled out of solution and essentially crystalized. This was rather worrisome for me. I know that I had followed the mixing and storage instructions to the letter. I was worried that this would in fact be a solution that I would have to prepare and use in the same day. Coupling this with a rather long extraction protocol could be very problematic! I used a magnetic stirrer on a hotplate to mix the solution for approximately 1/2 hour to no result. I was very hesitant to heat it while mixing as I didn't want to take the chance of denaturing any of the active ingredients within. Well, until I realized I will be heating it to 50 degrees C in my protocol! I applied very minimal heat while mixing and within 15 to 20 minutes there were no traces of precipitants left! </div>
Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com1tag:blogger.com,1999:blog-2481837686846186453.post-62124801288131405232014-10-09T14:27:00.002-07:002014-10-09T14:32:07.658-07:00Another hitchYet another hitch in my protocol.<br />
<br />
When locating the required chemicals for my protocol, I took it on word that we had phenol on hand. Knowing someone else had conducted aDNA extraction with it, I assumed (there is the problem) that it was what I needed. What I was not aware of was the phenol available in the lab is a pH 6.6, this would be suitable for an RNA extraction. DNA extractions require a pH in the range of 7.5-8.0.<br />
<br />
I caught this last friday, and Matt immediately ordered the appropriate phenol solution for me. It is supposed to arrive sometime in the next couple of days.<br />
<br />
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjyPHZTPfis6UYBqyazUhwoET1M5aS1AuRGtWZb8bHb9DTxfrExRvS2kXXi9bCl5dgRgjKh8BZL7kAzDxranH4k_I99toP7ZBuB3i2qDtsLNfAJo0ZgmuhuCjTCByZlw6B4rWnMFAFtBqI/s1600/photo-4.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjyPHZTPfis6UYBqyazUhwoET1M5aS1AuRGtWZb8bHb9DTxfrExRvS2kXXi9bCl5dgRgjKh8BZL7kAzDxranH4k_I99toP7ZBuB3i2qDtsLNfAJo0ZgmuhuCjTCByZlw6B4rWnMFAFtBqI/s1600/photo-4.JPG" height="320" width="239" /></a></div>
<div class="separator" style="clear: both; text-align: center;">
<span style="font-size: x-small;">the small print is there for a reason</span></div>
<br />
A fair amount of waiting time could have been avoided if I would have had the presence of mind to physically check the chemicals on hand. Lesson learned for future use.<br />
<br />
My last few posts to this blog might convey a general tone of discouragement or dissatisfaction with my work. I thought it might be prudent of me to state this is not the case. Yes, the problems I have run into have been mildly irritating, but this is part of the process. I am still just as intrigued and interested in this as when I started out! I accept the challenges and will overcome them and hope to see some positive results by semester end.<br />
<br />Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com0tag:blogger.com,1999:blog-2481837686846186453.post-11967105249978285752014-10-02T10:27:00.000-07:002014-10-02T10:27:22.361-07:00Stay on target...Last week, I relayed my issue concerning the concentration of proteinase k in the SDS/sarkosyl lysis buffer. Upon further research I have found several protocols that use the higher concentration (20mg/mL) of proteinase in their lysis buffer. I will be using this concentration in my first trials.<br />
<br />
I also spent a fair amount of time researching safety protocol for sarkosyl. In higher concentrations, sarkosyl is a particularly nasty substance. The stock solution that was purchased for me is a fairly strong solution: 30%. As noted in the previous post, the "recipe" for the buffer calls for 25g of sarkosyl and as I mentioned my stock is a 30% solution. This was done intentionally, the powdered form of sarkosyl is deadly upon inhalation. Using sarkosyl in solution greatly reduces the risks associated with its handling. It does make the calculations of how much to add to get the appropriate concentration in the final solution a little more complicated, but what's a little extra math for safety's sake. While researching handling safety of chemicals is generally a good lab practice, we are being especially cautious with sarkosyl as it is a cell lysis buffer - it breaks down cell membranes, and I would like to keep mine intact.<br />
<br />
Protocol for handling will include the usual necessary PPE: gloves (I did research solubility factors to select appropriate gloves), safety goggles, and lab coat to prevent accidental contact. I will also be handling the stock solution in the fume hood to avoid any vapor contact. The buffer I am creating will be much easier to handle as the sarkosyl will be diluted down to 5%.<br />
<br />
I have also scaled back the overall volumes of the solutions made. For instance, the "recipe"for the 5% sarkosyl component of the lysis buffer will make 500mL. I don't need to have that much of the buffer, especially as it is untried as of yet. I have scaled back the amounts by a factor of 5, resulting in a total of 100mL. The same is being done for all of the reagents I will be using.<br />
<br />
Looks like I am finally about to pick up where I left off at the end of last semester.<br />
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjPQW2CgxcjQz9ivFjP1JYdPvU9w9PWzlZDt_cd3PQgiNfgtsn4szHi4SPSocuJTrbCu7YgZ2SFhHgAUI6179tG6XO1E2RmWGRGjK_2hNiYxEO-LqtpB3gjQUyWjwQCndlTQv69kvM52GY/s1600/ppe.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjPQW2CgxcjQz9ivFjP1JYdPvU9w9PWzlZDt_cd3PQgiNfgtsn4szHi4SPSocuJTrbCu7YgZ2SFhHgAUI6179tG6XO1E2RmWGRGjK_2hNiYxEO-LqtpB3gjQUyWjwQCndlTQv69kvM52GY/s1600/ppe.jpg" /></a></div>
<br />
<br />
<br />Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com0tag:blogger.com,1999:blog-2481837686846186453.post-44562118639336499542014-09-25T14:55:00.000-07:002014-09-25T14:55:33.841-07:00Que sera seraThis week, I reviewed my latest protocol in order to locate all of the chemicals required, most of which were already on hand in the lab. There were only two things on my "shopping list" that needed to be ordered: sarkosyl and proteinase k.<br />
<br />
Sarkosyl is a surfactant (read detergent). Surfactants work on the basis of lowering the surface tension of liquids they are introduced to. For example oil and water do not "mix," with the introduction of the proper surfactant they could be mixed. Sarkosyl's role in DNA extraction is in the disruption of membranes that is, it renders the proteins within the cell membrane soluble, thereby assisting in lysing the cell.<br />
<br />
Proteinase k is an enzyme (hence the "ase" part of its name) that acts upon proteins (the protein part of its name). It will essentially digest proteins that contaminate the extraction results. It will also act upon any nucleases (that are present naturally) and negate their breaking of nucleotide chains (DNA strands).<br />
<br />
So the order was made and I'm just waiting on these two items to come in and then I can create my reagents and off I go.<br />
<br />
or so I thought...<br />
<br />
Upon detailed examination of my protocol (an attempt to fully understand every step in process to make it easier when I actually conduct the extraction), I noted this:<br />
<br />
<br />
<div class="page" title="Page 10">
<div class="layoutArea">
<div class="column">
<span style="font-family: 'TimesNewRoman'; font-size: 13.000000pt;">• SDS/Sarkosyl lysis buffer<br />
3 volumes of 4% SDS buffer<br />
1 volume of 5% Sarkosyl Buffer<br /><span style="background-color: blue;">
5 μg/mL proteinase K</span><br />
0.12% of </span><span style="font-family: 'TimesNewRoman'; font-size: 13.000000pt;">β</span><span style="font-family: 'TimesNewRoman'; font-size: 13.000000pt;">-mercaptoethanol<br />
Add 200 μL of <span style="background-color: blue;">Proteinase K (2Omg/mL)</span> and 100 μL of </span><span style="font-family: 'TimesNewRoman'; font-size: 13.000000pt;">β</span><span style="font-family: 'TimesNewRoman'; font-size: 13.000000pt;">-mercaptoethanol to 60
mL of 4% SDS buffer, and 20 mL of 5% sarkosyl buffer.<br />
Do not refrigerate or autoclave. </span><br />
</div>
</div>
</div>
<br />
<br />
It appears as though there is some conflicting information (high-lited in blue). The first 4 lines of the quote above are like the ingredients of the buffer, and the sentence beginning with add is like the recipe of how to make it. Five micrograms per milliliter and twenty milligrams per milliliter are vastly different concentrations! I could understand if the first concentration given was higher than the other - that would indicate that I would need to make a dilution of it in order to conform to the "recipe." How exactly would I get from a lower concentration to a higher though? I consulted with Josh and Matt and they were also unable to make sense of this either. Our consensus was for me to find other protocols that use proteinase k and compare concentrations.<br />
<br />
Just when I thought I was done digging through protocols... que sera sera...<br />
<br />
<br />
<div class="separator" style="clear: both; text-align: center;">
<iframe allowfullscreen='allowfullscreen' webkitallowfullscreen='webkitallowfullscreen' mozallowfullscreen='mozallowfullscreen' width='320' height='266' src='https://www.youtube.com/embed/azxoVRTwlNg?feature=player_embedded' frameborder='0'></iframe></div>
<div class="separator" style="clear: both; text-align: center;">
<br /></div>
<div class="separator" style="clear: both; text-align: left;">
<span style="text-align: -webkit-auto;">To date, I haven't delved into this fully. It does appear that 20mg/mL is a common concentration for proteinase k. I will look into this more as I want to be certain so the potential for error is reduced.</span></div>
<br />
<br />
<br />
<br />
<br />Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com0tag:blogger.com,1999:blog-2481837686846186453.post-37602925281277579192014-09-18T15:15:00.002-07:002014-09-18T15:15:38.085-07:00New Protocol ReduxLast week I spoke about being very happy with a new extraction protocol that I had found. Scratch that. Upon further investigation into it, I relised that the protocol listed all of the chemicals required for each of the buffers used, but failed to itemize the ratios of these chemicals in the solutions. Essentialy, I had the ingredients without the recipe.<br />
<br />
After several more hours of digging I came upon a great resource website: <a href="http://www.protocol-online.org/">http://www.protocol-online.org</a>. Through this site, I came upon an outstanding list of DNA extraction protocols from the University of Wisconsin-Madison: <a href="http://labs.medmicro.wisc.edu/mcfall-ngai/papers/2002nish3.pdf">http://labs.medmicro.wisc.edu/mcfall-ngai/papers/2002nish3.pdf</a>. From this list I will be using protocol 17, sans the liquid nitrogen. The "outstanding" part of this list is the detailed list of exactly how to make many of the common reagents for DNA extraction. The shopping list begins.<br />
<br />
Last Friday I did make it back out to my sampling site at Squaw Peak and collected fresh specimen from the same subjects I have been working with. I was more than a bit worried that the recent monsoon activity would negatively impact my field location as it is a wash. At first blush, there did not seem to be any major changes, but I was unable to observe the site closely as I was pressed for time. I will be returning in the not to distant future to more closely examine the site for changes (are more of the root systems exposed showing the relation between individuals). I spent a little over an hour collecting leaf samples, washing them in ethanol, and labeling them. They are currently in storage at -80 degrees Celsius.<br />
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg0m3z2qVBhpamKKpeSIOlzS7qzro5qdfJ5THXPIK2TYTKqII1URCLg1igk1traFT5Pd6Id3iLsJpS3uQkSmKSn4fVkciuJb3FWh0AQece14bVVeN0YWu1SH4eSpSeWfMOyaqvHE2zaHS4/s1600/photo+2.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg0m3z2qVBhpamKKpeSIOlzS7qzro5qdfJ5THXPIK2TYTKqII1URCLg1igk1traFT5Pd6Id3iLsJpS3uQkSmKSn4fVkciuJb3FWh0AQece14bVVeN0YWu1SH4eSpSeWfMOyaqvHE2zaHS4/s1600/photo+2.JPG" height="320" width="239" /></a></div>
<br />Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com1tag:blogger.com,1999:blog-2481837686846186453.post-81696913275542166822014-09-11T15:05:00.000-07:002014-09-11T15:05:03.644-07:00A new protocol<span style="color: white; font-family: inherit;">I have found a new protocol for DNA extraction that uses a couple of elements that I have not used before. This protocol from Plant Molecular Biology Reporter seems straightforward enough, and uses a chemical, hexadecyltrimethylammonium bromide <span style="line-height: 22px;">CTAB, will alleviate interference from various metabolites present in plants. It also uses a chloroform:isoamyl alcohol which separates proteins and polysaccharides from the nucleic acids in order to yield a cleaner extraction. After looking rather extensively at my results from last semester, I feel that my main issue was not being able to obtain a clean genetic extraction. Keeping this in mind, I will also be obtaining new leaf samples (from the same subjects as before) and adding a step when collecting them as well. When each sample is obtained, I will give them a quick wash with ethanol to remove any pontential environmental </span><span style="line-height: 22px;">contaminants. </span></span><br />
<span style="color: white; font-family: inherit;"><span style="line-height: 22px;"><br /></span></span>
<span style="color: white; font-family: inherit;"><span style="line-height: 22px;">Tomorrow I will go through my laundry list of required reagents and see what the lab has on hand, and what will need to be ordered. If time permits tomorrow, I will head out and collect the new samples. If I cannot do this tomorrow I will most likely do so over the weekend as I want to get started with extractions as soon as possible. I can already feel the clock ticking on this semester.</span></span><br />
<span style="color: #252525; font-family: inherit;"><span style="line-height: 22px;"><br /></span></span>
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj6dkObaZsyobhOrrjln2E4QE3h9aFpkx1HAC-BRLtpxHssgpEz-sO0YUQYwVCZC9pS4ZsDXjmIxN2ehcbGQ2YcpBpG-xnRHh76xamhw76yn14oxvo1s-OCzeegTJOB39zNFnW6hu3-KnQ/s1600/time1.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj6dkObaZsyobhOrrjln2E4QE3h9aFpkx1HAC-BRLtpxHssgpEz-sO0YUQYwVCZC9pS4ZsDXjmIxN2ehcbGQ2YcpBpG-xnRHh76xamhw76yn14oxvo1s-OCzeegTJOB39zNFnW6hu3-KnQ/s1600/time1.jpg" /></a></div>
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgLRMSkzmniczvAS7uLagrWmwyIdxRQQvtPbv4CopAlDXmUnUhvbuJ6Dzp-aekXeTi8gfvjmozCBILt-mwODzGSpsc8QD8e_1qWhlkpASjFQK1iI7SMCccBUC8usA9EGX2k6bNi9EDGOgM/s1600/thyme2.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgLRMSkzmniczvAS7uLagrWmwyIdxRQQvtPbv4CopAlDXmUnUhvbuJ6Dzp-aekXeTi8gfvjmozCBILt-mwODzGSpsc8QD8e_1qWhlkpASjFQK1iI7SMCccBUC8usA9EGX2k6bNi9EDGOgM/s1600/thyme2.jpg" /></a></div>
<div style="text-align: center;">
<span style="color: #252525; font-family: inherit;"><span style="line-height: 22px;"><br /></span></span></div>
Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com0tag:blogger.com,1999:blog-2481837686846186453.post-58966322643967860182014-09-05T11:00:00.000-07:002014-09-18T14:52:10.454-07:00Another beginning or a continuationAh fall semester here you are again.<br />
<br />
This semester I will be continuing my research with our friend the good old Palo Verde. Through my previous research I have very good observational evidence that the Palo Verde does reproduce through cloning in addition to it's typical sexual reproduction. I also attempted to show this through the comparison of the genetic makeup of individuals suspected of being clones. Unfortunately, last semester I was not able to produce a viable genetic extraction protocol for the Palo. It is my hope that this semester I will be able to perfect my extraction methodology and produce good samples for PCR amplification (and later comparison). I already have several ideas for cleaning up my extractions and will begin looking for better techniques to use.<br />
<br />
I also would like to delve a little further into the ecology of the desert wash as well. In my observations of the Palo in the field, I noticed several very unique characteristics of the wash environment and would like to explore them in a little more depth. Specifically speaking the composition of the soil layers.<br />
<br />
So, here's to another adventure in science!<br />
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhJGDKflWheWfehBMxtIfeGc_gd8ntwda3Wfchziv3WQXovXTmgTii2-byoiN74OFaF2rFCIIHbNkNKA9IfCEfbiIubZP7HWgGIRvebq32qek-EQsj4hRLP_tS9jRH58qiUgJp9RQgk44w/s1600/cheers1.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhJGDKflWheWfehBMxtIfeGc_gd8ntwda3Wfchziv3WQXovXTmgTii2-byoiN74OFaF2rFCIIHbNkNKA9IfCEfbiIubZP7HWgGIRvebq32qek-EQsj4hRLP_tS9jRH58qiUgJp9RQgk44w/s1600/cheers1.jpg" height="240" width="320" /></a></div>
<br />Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com2tag:blogger.com,1999:blog-2481837686846186453.post-16497627757372163962014-05-01T08:59:00.000-07:002014-05-01T08:59:21.767-07:00The end... again...Well, here we are at the end of the semester again. As I write this, my comrades-in-arms of the S-STEM program are at the Estrella Mountain Community College campus getting prepared for their poster presentations at the student conference. Unfortunately, my research was not accepted for presentation at this conference. In all actuality, I am happy about this. Due to failures in being able to produce good results with my genetic extractions, I would have only been able to present evidence based on the observable characteristics of the Palo Verde rooting systems. Even though this is very good information, it would have felt like I was only presenting half of my work. That does not sound like a big deal, but to those that know me, it kind of is. I feel that there is a lot of potential in this project and I want to see it to its end and be able to present the totality of the work. I hope that I am lucky enough to still be involved in this program next semester to be able to conclude (successfully, I hope) this research.<br />
<br />
Having said all of that I wish the best for my fellow stemmers presentations today and look forward to seeing everybody's work displayed/presented tomorrow in the lab. Speaking of which, I need to put the final touches on my PowerPoint presentation for tomorrow, so I will leave you with this:<br />
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjnYyYixgM9PfVQRFXg2NOcMz-u4abg52FUObkl2PwGxRmKT8Uarih29f05aS2rszc8CDrEghJk7Nrz5VOS2vooeMmSlTEEJfHqhrrNHFWegAI14ptCBQfthFrBC7wXnBeo7vuarEVoCG0/s1600/IMG_2605.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjnYyYixgM9PfVQRFXg2NOcMz-u4abg52FUObkl2PwGxRmKT8Uarih29f05aS2rszc8CDrEghJk7Nrz5VOS2vooeMmSlTEEJfHqhrrNHFWegAI14ptCBQfthFrBC7wXnBeo7vuarEVoCG0/s1600/IMG_2605.JPG" height="233" width="320" /></a></div>
<div class="separator" style="clear: both; text-align: center;">
Credit unknown, my wife sent me this in jest. </div>
<div class="separator" style="clear: both; text-align: center;">
<br /></div>
<div class="separator" style="clear: both; text-align: left;">
I thought it poignant. It seems after all the design and preparation involved in a presentation, nobody ever really considers how to end it. This can lead to a very awkward and uncomfortable moment... :)</div>
<div class="separator" style="clear: both; text-align: left;">
<br /></div>
<div class="separator" style="clear: both; text-align: left;">
Good luck everybody</div>
<div class="separator" style="clear: both; text-align: left;">
<br /></div>
<div class="separator" style="clear: both; text-align: left;">
Hope to see you all next semester!</div>
<br />Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com1tag:blogger.com,1999:blog-2481837686846186453.post-63508628525190309072014-04-24T12:44:00.002-07:002014-04-24T12:44:37.900-07:00Good news of a sortLast Friday I ran gel electrophoresis with a 0.5% agarose gel instead of the normal 1% gel. I did not get the results I had hoped for, but I did observe some travel in the gel!<br />
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEirAqfm640AXam0PR7jX6BiWLrSjrLAEigGPGKdGOBpsIn3l_8kg76iQE8bG-GzGtqmhgCJQJlAUejaCtBd-iHDrETU5C-a22rOY9KXEFagxqdt-mhyNLQtK5g2i-ENji9A0S7caqzuup4/s1600/4-18gel.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEirAqfm640AXam0PR7jX6BiWLrSjrLAEigGPGKdGOBpsIn3l_8kg76iQE8bG-GzGtqmhgCJQJlAUejaCtBd-iHDrETU5C-a22rOY9KXEFagxqdt-mhyNLQtK5g2i-ENji9A0S7caqzuup4/s1600/4-18gel.JPG" height="243" width="320" /></a></div>
<div style="text-align: center;">
<br /></div>
<br />
In lane number 5 (from left), a very faint band can be seen about halfway down. I consulted with Matt and Josh, the leading thought is that something is working (the band though faint is still there), but not working well. It is believed the specific primers used are not effective. This is not a very big issue at all. There are seven different UPRs (Universal Rice Primers) currently available in the lab, four of which I have yet to use. Hopefully one of the other four will be able to amplify an SSR (Simple Sequence Repeats) in my Palo samples.<br />
<br />
Now I need to conduct another DNA extraction from leaf samples, check it with gel electrophoresis, run a PCR with each of the four URPs, and another gel with each of the PCR results, analyze the results to see which, if any, is successful, and then apply the whole process to the each of the samples I collected... Oh wait... what's that? The semester is over next week?<br />
<br />
given that, I have had to adapt my poster presentation and research paper to focus on the observable data collected. Hopefully next semester my participation in this program will be renewed and I will be able to continue with this research.<br />
<br />
<br />Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com0tag:blogger.com,1999:blog-2481837686846186453.post-23527619556910824242014-04-17T18:13:00.001-07:002014-04-17T18:14:03.501-07:00Here we go again.It seems that every week as I finish writing my blog update I think, maybe next week will be the week when I will be able to post positive results.<br />
<br />
Not the case.<br />
<br />
Don't get me wrong, I am not discouraged in the least. If anything, the lack of results is a motivator. Getting good genetic evidence of what I am trying to prove has now become sort of a personal challenge (or vendetta?). I am running out of time for this semester though.<br />
<br />
Upon completion of the PCR amplification of the DNA extraction, I conducted another gel electrophoresis. As I have seen many times this semester, the material did not travel in the gel. Under UV light, the wells containing the PCR results from the Sigma extraction did glow, but there was no evident travel through the gel.<br />
<br />
Electrophoresis separates the molecules based on size. Larger DNA strands will travel much slower than the smaller ones. After a period of time with 100 volts pulling the negatively charge DNA molecules toward the negative pole of the gel box, a separation of the fragments can be seen. Based on this principle behind the separation, I am now questioning if the issue has to do with the size of my sample's DNA fragments. Is it possible that the fragments are simply too big to travel through the gel? In my research I have not come upon anything regarding this.<br />
<br />
The gel used is a 1% agarose gel. It is made by adding 1 gram of molecular grade agarose to 100mL of 50x TAE buffer, and heating/mixing it to a clear solution and then pouring it into a mold (the gel box tray) and allowing it to cool. My newly developing theory is that if the DNA fragment is too large to travel through the gel, why not alter the concentration of agarose to make it easier for the fragment to travel. I have no idea if it will work, but today I made a 0.5% agarose solution and poured a gel. I did not have enough time to run the gel, but I will be able to do so tomorrow. Maybe it will work, maybe not.<br />
<br />
I am now up against the wall as far as being able to present results at MetroTech, and complete my research paper. Should I obtain the positive results I hope for tomorrow, I am not sure that I have enough time left to interpret them. I believe what I am going to have to do is focus on structuring poster for presentation and the my research paper around the observational work I have done - mapping and imaging of the site it itself showing the spatial interrelation of the subjects and their respective root systems (or better stated the portions of the root systems that can be seen). This will not be near as exciting as what I hoped to accomplish, but it is something. I do not know if I will be selected for renewal of the S-STEM scholarship for a third semester, but I certainly hope so. I want to prove the Palo Verde does reproduce through cloning in addition to sexual reproduction.<br />
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjlsyx_QU9UuoE8CKsOFvXyQv8zOCRQZLpLOD_In_XuCzwbEkrN_Hq8eR4kzzDuGCw_CD6X0vLbHuaqGo0LFB6mpHmKoiIX9mVekPKhtl-oG4PbsBP4zipEkHomv1p9JypyRrw9k7FQWmY/s1600/photo+copy+3.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjlsyx_QU9UuoE8CKsOFvXyQv8zOCRQZLpLOD_In_XuCzwbEkrN_Hq8eR4kzzDuGCw_CD6X0vLbHuaqGo0LFB6mpHmKoiIX9mVekPKhtl-oG4PbsBP4zipEkHomv1p9JypyRrw9k7FQWmY/s1600/photo+copy+3.JPG" height="297" width="400" /></a></div>
This is the best picture of potential cloning in <i>Parkinsonia microphylla </i>I have taken.<i> </i>It is quite obvious that the root system coming from the main portion of the biomass on the left is in fact sending up additional shoots. Notice the large developed shoot on the right and the smaller/newer shoots between the two. They all originate from the same root system.Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com0tag:blogger.com,1999:blog-2481837686846186453.post-27677584731820943922014-04-10T08:46:00.002-07:002014-04-10T08:46:18.284-07:00I think we may have a winnerOn Monday I completed an extraction with the new method I devised and ran a gel with it as well as the results from the previous Sigma Aldrich extraction. My new extraction did not seem to produce any results, but the Sigma extraction again showed a nice heavy band as seen below.<br />
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi2XaDbcwzwuhqAH060FUuAatdAkX2OYMec5DxcgxFJlan9OdPvDV0Uvq6VurkEaU6_PGsSJKb4Gzwr2Esbeq7InbaUY5i8qIAXsLIz3tfOgxDbBhe7-iAugq1TIWk4c5b5Z5wTl1aas-8/s1600/4:7+success.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi2XaDbcwzwuhqAH060FUuAatdAkX2OYMec5DxcgxFJlan9OdPvDV0Uvq6VurkEaU6_PGsSJKb4Gzwr2Esbeq7InbaUY5i8qIAXsLIz3tfOgxDbBhe7-iAugq1TIWk4c5b5Z5wTl1aas-8/s1600/4:7+success.JPG" height="640" width="476" /></a></div>
<div style="text-align: center;">
<span style="font-size: x-small;">The wells from left to right: 1 - the new extraction method, 2 - the Sigma extraction, 3 + 4 - empty, 5 - ladder, 6 - empty, 7+8 - samples Josh asked me to run (<i>Staphylococcus aureus - </i>I don't know the extraction method). </span></div>
<div style="text-align: center;">
<span style="font-size: x-small;"><br /></span></div>
<div style="text-align: left;">
It certainly is nice to see a big heavy band of genomic DNA. I had intended to conduct a PCR this week using the Sigma extraction but my plans changed... Tuesday I was unable to be in the lab as normal due to a honey bee swarm taking up residence in my house! This required me to bee there (nice pun?) Tuesday. I was made aware that the rough draft of our research paper for this semesters projects is due Thursday (today). For some unknown reason I was under the impression that I had another week. So, I spent a fair amount of time yesterday in the lab working on the draft, and more than a few hours working on it late last night. There is a downside to working late into the night - sometimes mistakes are made, sometimes they are big ones, sometimes you evidently don't save the work you are doing... I am not all the way back to square one, but I lost a lot of work. </div>
<div style="text-align: left;">
<br /></div>
<div style="text-align: left;">
I decided to clear my head and get into typing mode by posting this edition of my blog. Now it's time to get back on the paper. </div>
<div style="text-align: left;">
<br /></div>
<div style="text-align: left;">
and awaaaaaay we go...</div>
Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com0tag:blogger.com,1999:blog-2481837686846186453.post-86769065068688250142014-04-03T15:29:00.000-07:002014-04-09T08:13:57.396-07:00Denied...This week I finally heard back from the Estrella Mountain Community College Student Conference. They regret to inform me that they have not accepted my research proposal for this years conference. This does not worry me as I will find another outlet to present my data. The notification E-mail from EMCC contained a couple of abbreviated comments on my proposal that I find interesting.<br />
<br />
1: "Seems to be two projects here..., reproduction and adaptation to washes... It is a bit muddled."<br />
<br />
I feel that my proposal pretty clearly stated that the reproduction (cloning) IS an adaption to thriving in the washes.<br />
<br />
2: "Not sure if his methodology will actually yield the results he is looking for."<br />
<br />
I am recording qualitative (observable) data that shows cloning in the Palo Verde, and supporting that, I am conducting genetic analyses to prove that cloning is occurring. Just exactly what other methodology could be used to do this?<br />
<br />
OK complain fest is over!<br />
<br />
Matt Haberkorn and I went back to the sample plot at Squaw Peak and recorded topographical data from the terrain in a 3 coordinate system. Using this data I was able to create this site map:<br />
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://www.blogger.com/blogger.g?blogID=2481837686846186453" imageanchor="1" style="clear: right; float: right; margin-bottom: 1em; margin-left: 1em;"></a><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi_piN9y9ErFqRDU4owlyg1PJxdJG1fi6furymyz-X-Ft9QkW9Zp8jZaWgy3q9M9hhhyphenhyphenLJvaQA9L3C9QIGyoyFKxWpmtYNMIwFB2Mbw_7FLMSbDfebIjT5srpWGGUm2d2e9lJ6lO-wkJ7E/s1600/plot+img.png" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi_piN9y9ErFqRDU4owlyg1PJxdJG1fi6furymyz-X-Ft9QkW9Zp8jZaWgy3q9M9hhhyphenhyphenLJvaQA9L3C9QIGyoyFKxWpmtYNMIwFB2Mbw_7FLMSbDfebIjT5srpWGGUm2d2e9lJ6lO-wkJ7E/s1600/plot+img.png" height="275" width="400" /></a></div>
<br />
<div style="text-align: center;">
</div>
<div style="text-align: center;">
<br /></div>
<div style="text-align: left;">
This data was collected by the use of two meter sticks with levels attached. The first was held vertically (plumb) at the "0" mark of the transect line and the second was extended a full meter from the first and lowered until the far end connected with the bank. When held level, this indicated the elevation change to the far point. The vertical stick was then moved up the bank to the exact spot the horizontal stick made contact and the process repeated until we reached a point beyond the highest specimen that I collected leaf samples from. We then reset and began from the one meter mark on the transect line, and continued until the entire plot was recorded on a one meter grid.</div>
<div style="text-align: left;">
<br /></div>
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEicMVdesuFrsIdAlJm8g-ZrKBl3QocEgN2Z7BD5jk1AFXES0CqSzExEN3-_5n9_7VnOaxFUR1xcWaRA8vu5z2PiK4vFpYx0CYoyg0Nr5aQUUdaXLoysvviyoro5WOuCi6xoB0BhOZmR1-Q/s1600/site2.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEicMVdesuFrsIdAlJm8g-ZrKBl3QocEgN2Z7BD5jk1AFXES0CqSzExEN3-_5n9_7VnOaxFUR1xcWaRA8vu5z2PiK4vFpYx0CYoyg0Nr5aQUUdaXLoysvviyoro5WOuCi6xoB0BhOZmR1-Q/s1600/site2.JPG" height="320" width="239" /></a></div>
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiFKTJWdjCACwOngbhLW12KKxNiljZ8eUqCxKSk5J0xFhdOJT4RyKkA8QqkKeKLayONN_PCBdOvA1M4Vv_RvicOQtRNh5tqHRkIS2zpB1srOsqkyDZP9J2AzklUqPIC4gZ-bQIcgEC6cog/s1600/site1.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiFKTJWdjCACwOngbhLW12KKxNiljZ8eUqCxKSk5J0xFhdOJT4RyKkA8QqkKeKLayONN_PCBdOvA1M4Vv_RvicOQtRNh5tqHRkIS2zpB1srOsqkyDZP9J2AzklUqPIC4gZ-bQIcgEC6cog/s1600/site1.JPG" height="320" width="239" /></a></div>
<div class="separator" style="clear: both; text-align: center;">
Matt and I at work</div>
<div class="separator" style="clear: both; text-align: center;">
<br /></div>
<div class="separator" style="clear: both; text-align: left;">
We will be returning tomorrow to collect data and high resolution images of root systems. We decided that we have a bit better of a method to plot the actual location of the specimens.</div>
<div style="text-align: center;">
<br /></div>
Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com0tag:blogger.com,1999:blog-2481837686846186453.post-88896895063644201042014-03-27T21:19:00.001-07:002014-03-27T21:22:16.322-07:00(about) TIme for Progress.The reagents for the extraction buffer have arrived and I will be able to run the wizard kit again early next week. It is my hope that it will be more successful this time around.<br />
<br />
While waiting for the reagents I went ahead and conducted another extraction with the Sigma-Aldrich kit. The genomic DNA results were FAR better than they had been previously! However, there may still be an issue. The DNA in the gel travelled much further than genomic DNA typically does, and the ladder is still coming out strange. The only causes I can think of that may be in effect here are either the ratio of agarose to TAE buffer in the gel is off, or the dilution of the TAE itself is off. I have checked, rechecked, and checked again my math on these products. I feel like I am really reaching to find a problem here.<br />
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhp97syZcE8zhpgTnkB5g9lLtAjYobl2e1e7wAP4n2C_V182MGX3ymY8Wnynysgt8qOycbIavUViFvPj7gpuE02oW1Y6bdyBPWnL_A8bFCI4VYwZNjU900a6-quhAlK5-TQl2qXXPRyLJA/s1600/genomic+gel+img2+3%253A26.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhp97syZcE8zhpgTnkB5g9lLtAjYobl2e1e7wAP4n2C_V182MGX3ymY8Wnynysgt8qOycbIavUViFvPj7gpuE02oW1Y6bdyBPWnL_A8bFCI4VYwZNjU900a6-quhAlK5-TQl2qXXPRyLJA/s1600/genomic+gel+img2+3%253A26.JPG" height="320" width="239" /></a></div>
<div class="separator" style="clear: both; text-align: left;">
This is the gel as viewed under uv light. The faint dotted horizontal line represents the wells that the samples were placed in. the purple band on the left is the extracted genomic DNA. Notice how far it has travelled in the gel. It is my understanding that it should have traveled less than half that distance. Genomic DNA is large and should not travel so readily through the gel. The vertical streak on the right is the ladder or molecular marker that I used. It is also strange in that it should have not been a amear like this.</div>
<div class="separator" style="clear: both; text-align: left;">
<br /></div>
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiHaSRLwBndLBXM5pzsxTqbdQXnD6s1PWNdhs7TFn8EnV3378j3YXcTsfaciEIgyvh5hhGs4XRbAMT5oajML-loQvomThBQ5NS634M0VGWSzL6Js7JtW6DsSKhSNqVP-jmOlQU0RiwWBKo/s1600/genomic+gel+img1+3%253A26.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiHaSRLwBndLBXM5pzsxTqbdQXnD6s1PWNdhs7TFn8EnV3378j3YXcTsfaciEIgyvh5hhGs4XRbAMT5oajML-loQvomThBQ5NS634M0VGWSzL6Js7JtW6DsSKhSNqVP-jmOlQU0RiwWBKo/s1600/genomic+gel+img1+3%253A26.JPG" height="320" width="239" /></a></div>
<div class="separator" style="clear: both; text-align: center;">
A closer image of the same gel.</div>
<div class="separator" style="clear: both; text-align: left;">
<br /></div>
<div class="separator" style="clear: both; text-align: left;">
I am interested to see what will come from running a PCR amplification on this extraction sample. I will run the PCR once I have extracted DNA through the wizard kit next week and run both samples at the same time.</div>
<div class="separator" style="clear: both; text-align: left;">
<br /></div>
<div class="separator" style="clear: both; text-align: left;">
On another note, I will be heading out to the sample plot at Squaw Peak with Matt Haberkorn tomorrow afternoon to record data for the 3d plot map I am creating. I will use this data coupled with some root mapping to complement my genetic research into cloning in the Palo Verde. We will also be doing some foliage cover estimates to compare and contrast the growth habits of the Palo in the washes as opposed to in the uplands. There may even be some soil sampling in the works to round out the data as a whole. Looking forward to be out on the site. It should be a nice way to wrap up a rather busy week.</div>
<br />Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com0tag:blogger.com,1999:blog-2481837686846186453.post-28299105086011742782014-03-20T20:45:00.002-07:002014-03-20T20:45:51.756-07:00again, and again, and again, again...Again, I will be starting over... I feel as though I have said that before. Early on this week I made the decision to retry the higher quality extraction with the wizard kit I used at the end of last semester. There was one slight hitch. The extraction buffer I used is no longer viable. Embarrassingly enough, as I recall, the buffer I used last semester was just given to me, and I had no idea of its composition or who made it. Much of this week was then spent researching different extraction methods and buffers that would wor<span style="font-family: inherit;">k for me. MANY of these call for the leaf sample to be frozen in liquid nitrogen and then ground up before adding buffers - not really an option for me. Also of note many methods require the use of phenol-chloroform (two nasty chemicals). I wasn't told not to use phenol-chloroform, but it felt as if it were implied that another method may be better.</span><br />
<span style="font-family: inherit;"><br /></span>
<span style="font-family: inherit;">After reviewing a rather large amount of scientific literature (predominately journals), I did find a method that didn't require the above. Unfortunately not all of the reagents required for the buffer were on hand, but we anticipate delivery early next week. The components of the buffer are:</span><br />
<span style="font-family: inherit;"><br /></span>
<span style="font-family: inherit;">200 mM Tris HCl pH 7.5 This maintains a stable pH in solution as cells are lysed.</span><br />
<span style="font-family: inherit;"><br /></span>
<span style="font-family: inherit;">250 mM NaCl Provides Na+ Ions that bond to the negatively charged phosphate groups that are part of DNA (if the Na+ didn't do this the molecules would repel each other)</span><br />
<span style="font-family: inherit;"><br /></span>
<span style="font-family: inherit;">25 mM EDTA<span style="color: #373737;"><span style="line-height: 18px; white-space: pre-wrap;"> </span></span></span>Is a chelating agent that neutralizes metal ions like Mg2+ and CA2+ which are needed by DNA polymerase and other enzymes. Doing so essentially stops the action of these enzymes and preserves the DNA in it's intact state.<br />
<br />
<span style="font-family: inherit;">0.5% SDS is a detergent.</span><br />
<div class="page" title="Page 1">
<div class="layoutArea">
<div class="column">
<span style="font-family: inherit;"> </span><br />
</div>
</div>
</div>
<span style="font-family: inherit;">I can't wait to finally get some results! The end of the semester is approaching much faster than I care to admit! </span><br />
<span style="font-family: inherit;"><br /></span>
<span style="font-family: inherit;">For general information good results would look something like this:</span><br />
<span style="font-family: inherit;"><br /></span>
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgq-ickketgUWY_Al3jOlwEgD80MhbH5PkSm9tbCGqlI3M1seX-J3g6SJw2RvZTBF_Vjp3hyA116Pw5GizrdmRzww3bePEmqOF8dOuO1viotYJuJpZAQ2cPKmVcnV8FbAcyzu1HpFQsS7Y/s1600/wizard.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgq-ickketgUWY_Al3jOlwEgD80MhbH5PkSm9tbCGqlI3M1seX-J3g6SJw2RvZTBF_Vjp3hyA116Pw5GizrdmRzww3bePEmqOF8dOuO1viotYJuJpZAQ2cPKmVcnV8FbAcyzu1HpFQsS7Y/s1600/wizard.jpg" height="320" width="268" /></a></div>
<div class="separator" style="clear: both; text-align: center;">
Image from Promega's website (the maker of the wizard kit.</div>
<div style="font-family: Helvetica; font-size: 12px;">
<br /></div>
Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com0tag:blogger.com,1999:blog-2481837686846186453.post-52680198633431460432014-03-06T18:26:00.001-08:002014-03-06T18:26:59.468-08:00Back At ItThis week I returned to working with my plant samples.<br />
<br />
At the end of last semester I began attempting DNA extractions on the samples of the Foothills Palo Verde using the Wizard extraction kit. Unfortunately there were no usable results from this. The protocol for this kit required the leaf sample to be ground up in solution and then pushed through a min-icolumn (like a filter) with a 5mL syringe. No matter how I ground the sample or changed the dilution rate, I had to exert a very large amount of force to push the sample through the media. Every time I attempted this, I essentially compressed the 4.5mL volume of air down to approximately 1mL before anything would pass through the column, and then it all went! I assumed that this was basically bypassing the filtration that was in place (blowing it out).<br />
<br />
This semester I started extracting using a system from Sigma-Aldrich that was an entirely different approach. This system did not require the grinding of the leaf material. The "quick and dirty" extraction method (this is how Matt and Josh referred to it) relied upon heat and an extraction solution. The end results were much the same. When gel electrophoresis was done, there was no traveling of DNA through the gel. Maybe this was because the extraction method was in fact a little too quick and dirty?<br />
<br />
This week I decided to try to combine the two methods. I used a sample from the Sigma-Aldrich sample and then passed it through the wizard kit. My thinking was the Wizard kit didn't seem to handle the material although it should have yielded a better end product, and the SA system was able to handle the material but was a dirty extraction, why not try to use the better aspects of each and clean the dirty extraction with the finer system. Sounds logical right?<br />
<br />
Well... it didn't work.<br />
<br />
Again there were no visible bands in the gel. However it is of note that the genetic ladder or mass ruler that I used did not appear to run correctly either. The ladder is used as a comparison method for DNA. In a nutshell, gel electrophoresis works based on the size of DNA fragments. The samples are loaded in the gel and it is placed into the gel box that is filled with a liquid buffer (TAE). The gel is oriented so the DNA (which has a negative charge) is located near the negative pole of the electrophoresis system and will be drawn through the gel to the positive end when 120 volts is applied to the system (for 30 - 45 minutes). The larger the piece of DNA, the slower it will travel through the gel. A properly run sample will show different bands separated through the gel by the distance it travels. The ladder should have had clear solid bands at different distances through the gel. This was not the case, it was basically a long smear as shown in the picture below.<br />
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhEHuS05NpzNhu2zMJgN6vJC5AYDEDPu1Z-fG5C5QJ4h0QKI_eEpM9knUaAEWgLMIc21uXG68TUrLePhnm-tQsKNmP7Pu6dvah4Su7VgJ0uXZ4X4plHbhXjBau7u-TKKMRx2Ady4WSEpzY/s1600/photo-2.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhEHuS05NpzNhu2zMJgN6vJC5AYDEDPu1Z-fG5C5QJ4h0QKI_eEpM9knUaAEWgLMIc21uXG68TUrLePhnm-tQsKNmP7Pu6dvah4Su7VgJ0uXZ4X4plHbhXjBau7u-TKKMRx2Ady4WSEpzY/s1600/photo-2.JPG" height="320" width="239" /></a></div>
<div style="text-align: center;">
<br /></div>
First off, yes the top of the gel is melted. It was run longer than normal and that is the result. from left to right there are 8 "wells" for samples. The first two were my DNA extraction,then an empty well, then two of one ladder, another opening, and then two of another ladder. This image is under UV light, hence the glow. The smear I mentioned is obvious. There should be separate distinct bands at varying lengths down the gel. I am not sure if there is actually DNA in the wells of my sample or not. There is a discernible fluorescence in the well but that may just be the dye, I am not certain.<br />
<br />
What I do know is, there is something wrong in either my gel protocol or methods. I hate to admit it, but it is most likely user error...<br />
<br />
The gel is composed of 1% agarose to buffer solution. The buffer solution is a dilution of 50x TAE. Have I erred in my formulations of these two products? Maybe I need to use a different concentration of one or both of these products? Either way, I want to resolve this as quickly as I can. I would certainly like to move on with the rest of this project, I a m really excited to hopefully be able to prove the Palo does do some reproduction through cloning.<br />
<br />Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com0tag:blogger.com,1999:blog-2481837686846186453.post-54232254830178832712014-02-27T18:08:00.002-08:002014-02-27T18:08:47.791-08:00Another AngleThis week I decided to continue my hiatus from DNA extraction and PCR amplification. There is another angle of my research that I have yet to develop. When taking my samples at Squaw peak, I used an app on my phone to locate each sample's location in terms of GPS coordinates. I also sketched a map of the site.<br />
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh4wMZ7ytwcWlNJ1V70POA7daIR7p076-5ZZreOGmoNcfY5Pd5v2sGgHg1-Eos8dCuI738EmtOJIyHKQSTFliqTd4P1i5CbHi5Fj8E_TLE61kP1nsYe8VCxA1smKHK9aCRpLplZWc_iue0/s1600/plot1.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh4wMZ7ytwcWlNJ1V70POA7daIR7p076-5ZZreOGmoNcfY5Pd5v2sGgHg1-Eos8dCuI738EmtOJIyHKQSTFliqTd4P1i5CbHi5Fj8E_TLE61kP1nsYe8VCxA1smKHK9aCRpLplZWc_iue0/s1600/plot1.JPG" height="640" width="478" /></a></div>
<div class="separator" style="clear: both; text-align: center;">
The overall site sketch</div>
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg1Z9NfE-O4ERZKa2DPGM5UKpD8StNfLGybq_s6XCE2RRXYd51CQIw2A3dFU3EhHxGyBGuoN7yNmWayLMFC9NMlJlH5W7C39Iafrn1Zx8Xo4vP_MBXQyS-1tUazZfE7rGwd631OtCC1MQk/s1600/plot2.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg1Z9NfE-O4ERZKa2DPGM5UKpD8StNfLGybq_s6XCE2RRXYd51CQIw2A3dFU3EhHxGyBGuoN7yNmWayLMFC9NMlJlH5W7C39Iafrn1Zx8Xo4vP_MBXQyS-1tUazZfE7rGwd631OtCC1MQk/s1600/plot2.JPG" height="640" width="478" /></a></div>
<div class="separator" style="clear: both; text-align: center;">
A closer image of the area that I believe I will narrow my study down to.</div>
<div class="separator" style="clear: both; text-align: center;">
The arrow points to the line that will correspond with the horizontal axis below</div>
<br />
I did this not only so I would be able to return to the specific test subjects if needed (and I did need to), but also knowing that I would like to have a detailed map of some sort within my research paper and presentation. This week I developed a system that will allow me to accurately plot the site in three dimensions. It will be easier to explain the system when I can actually show some pictures of the operation. I am pretty confident it will work very well. What good are the three dimensional coordinates without a good mapping system? Well, none really! I spent some time digging around for good ways to map in three dimensions, and I think I've hit the nail on the head.<br />
<br />
<img height="316" src="webkit-fake-url://64050C60-586E-4E41-A13A-3418AF654221/application.pdf" width="640" /><br />
This is what I've come up with so far. Keep in mind these numbers are purely fictional. I was just trying to see what I could do with this system. The rough estimates of the overall plot size should be fairly accurate, but the topography is not. I am still working on how to plot the individual trees. We'll see what I can come up with!Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com0tag:blogger.com,1999:blog-2481837686846186453.post-7902963655754372122014-02-20T10:59:00.000-08:002014-02-20T11:03:05.604-08:00Holding PatternAs the title suggests, this week my experimentation with the Palo Verde was put into a holding pattern. At the end of the spring semester every year there is a student conference held at Estrella Mountain Community College. Each year students submit their research projects in the hopes of being selected to present the results of their work at the conference. As the deadline is fast approaching, this week I worked on developing and polishing an abstract for submission to the panel that reviews student's work for selection to the conference.<br />
<br />
There are a few odd things at play here... Submit an abstract before the work is done? Cite references in an abstract? Hmm, why don't we call this what it actually is, a research proposal? OK, so the actual nuts and bolts of writing it were actually not so bad. There is a rubric available, and it always helps to have a guide. Having said that, I am actually concerned about whether or not my work will be accepted. Evidently there is a theme to the conference. This year the theme is "Healthy Body, Healthy Soul." My work on proving cloning in <i>Parkinsonia mycrophilla</i> (the Foothills Palo Verde) as a genetic adaptation for survival in the Sonoran Desert is not really applicable to "Healthy Body, Healthy Soul." So, I have really worked on refining the language in the proposal in order to make it as interesting/intriguing as possible. If I am turned down hopefully I will be able to find another conference to apply to. We shall see...<br />
<br />
<div class="separator" style="clear: both; text-align: center;">
</div>
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjie0zoLwBLAK8JgyeAuikauDrrRvrrqROUyySHel9r6A_cNFm4gBIlN60g37CkL3zxy-eMqPp-1L2p2WmPcYEybWKZyqOWbLG8Qb4MG9uBCDVL8gBxf24GoeK1HzoE7Wp7x1WyV6FwZPc/s1600/did-you-get-ko0pj4.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjie0zoLwBLAK8JgyeAuikauDrrRvrrqROUyySHel9r6A_cNFm4gBIlN60g37CkL3zxy-eMqPp-1L2p2WmPcYEybWKZyqOWbLG8Qb4MG9uBCDVL8gBxf24GoeK1HzoE7Wp7x1WyV6FwZPc/s1600/did-you-get-ko0pj4.jpg" height="233" width="320" /></a></div>
<div class="separator" style="clear: both; text-align: center;">
<br /></div>
<div class="separator" style="clear: both; text-align: center;">
meme created on makeameme.org</div>
<div class="separator" style="clear: both; text-align: center;">
<br /></div>
<div class="separator" style="clear: both; text-align: center;">
<br /></div>
<div class="separator" style="clear: both; text-align: center;">
<br /></div>
<div class="separator" style="clear: both; text-align: center;">
<br /></div>
<div class="separator" style="clear: both; text-align: center;">
<br /></div>
<div class="separator" style="clear: both; text-align: center;">
<br /></div>
<div class="separator" style="clear: both; text-align: center;">
<br /></div>
<div class="separator" style="clear: both; text-align: center;">
<br /></div>
Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com0tag:blogger.com,1999:blog-2481837686846186453.post-23676287345795630002014-02-12T22:23:00.000-08:002014-02-12T22:23:19.497-08:00Endeavor to Persevere. Well as I said last week, my goal for this week was to attempt to discern what may be causing the difficulty with my DNA samples not traveling in the gels.<br />
<br />
Upon reviewing the protocols I used for the extraction and PCR process, I noticed two errors on my part that may or may not have been factors. The extraction system that I used called for an initial tissue sample of a size equivalent to a paper hole punch (4-6mm). I used a larger amount of leaf material in my extraction. Also, when I performed the PCR amplification on the extraction, I ran the gel using 2μL of loading dye, 2μL of SYBR green, and 16μL of the DNA. After polling several of the minds at my disposal, it was decided that this may have been too much. I thought that this may be reaching pretty far for a possible cause to my issues, but as the Sigma-Aldich extraction kit is easy and relatively quick to do, I decided to drop back and do another extraction with the appropriate amount of leaf material to start. When it came time to conduct the gel electrophoresis, I also modified the amounts to: 1μL of loading dye, 1μL of SYBR green, 6μL of ultra pure water, and 2μL of the DNA. This gel did not show favorable results either. Using the same PCR results, I ran yet another gel using 1μL of loading dye, 1μL of SYBR green, and 8μL of the DNA in hopes that maybe I would see something - not the case.<br />
<br />
Time for more research...<br />
<br />
The URP's that I used were as follows:<br />
<br />
1st: URP13R it's sequence of nucleotide bases is: 5'TACATCGCAAGTGACACAGG3'<br />
<br />
2nd: URP9F it's sequence of nucleotide bases is: 5'ATGTGTGCGATCAGTTGCTG3'<br />
<br />
3rd: URP6R it's sequence of nucleotide bases is: 5'GGCAAGCTGGTGGGAGGTAC3'<br />
<br />
In the program for the thermal cycler listed in the previous post, there are divisions of the cycle that are titled denat<span style="font-family: Times, Times New Roman, serif;">uring, and annealing. The higher temperature for denaturing is what allows the two strands of the DNA double helix to be unwound. Annealing is the temperature at which the Taq polymerase can add the new complimentary bases to the strand to duplicate it. My research into this led me to a formula on Sigma-Aldrich's website that determines the Tm (melting temperature) of the strand. Ta (annealing temperature) is 5<span style="font-size: 12pt;">°C less than that. </span></span><br />
<span style="font-family: Times, Times New Roman, serif;"><span style="font-size: 12pt;"><br /></span></span>
<span style="font-family: Times, Times New Roman, serif;"><span style="font-size: 12pt;">The formula: Tm = 4(# of G+C) + 2(# of A+T)</span><span style="font-size: 12pt;">°C</span></span><br />
<span style="font-size: 12pt;"><span style="font-family: Times, Times New Roman, serif;"><br /></span></span>
<span style="font-size: 12pt;"><span style="font-family: Times, Times New Roman, serif;">Using this and subtracting the </span></span><span style="font-family: Times, 'Times New Roman', serif;">5</span><span style="font-family: Times, 'Times New Roman', serif; font-size: 12pt;">°C, the </span><span style="font-family: Times, Times New Roman, serif;">annealing temperatures are URP13R - 55</span><span style="font-family: Times, 'Times New Roman', serif; font-size: 12pt;">°C, URP9F - </span><span style="font-family: Times, 'Times New Roman', serif;">55</span><span style="font-family: Times, 'Times New Roman', serif; font-size: 12pt;">°C, and URP6R - 55</span><span style="font-family: Times, 'Times New Roman', serif; font-size: 12pt;">°C. It is understood that it is best to go with the lowest Ta. I also found found several different Tm calculators online and they all varied within 51-</span><span style="font-family: Times, 'Times New Roman', serif;">55</span><span style="font-family: Times, 'Times New Roman', serif; font-size: 12pt;">°C. So today, using the second extraction of DNA, I ran another PCR and adjusted the annealing temperature to </span><span style="font-family: Times, 'Times New Roman', serif;">53</span><span style="font-family: Times, 'Times New Roman', serif; font-size: 12pt;">°C. I am so hopeful that this will solve the problem that I will go in to the lab tomorrow morning on a day that I am not normally scheduled to run another gel. Let's hope that i see something on the order of this!</span><br />
<span style="font-family: Times, 'Times New Roman', serif; font-size: 12pt;"><br /></span>
<a class="image" href="http://en.wikipedia.org/wiki/File:Agarosegelphoto.jpg" style="background-image: none; color: #0b0080; font-family: sans-serif; font-size: 12px; line-height: 19px; text-align: center; text-decoration: none;"><img alt="" class="thumbimage" height="267" src="http://upload.wikimedia.org/wikipedia/commons/thumb/a/a6/Agarosegelphoto.jpg/200px-Agarosegelphoto.jpg" srcset="//upload.wikimedia.org/wikipedia/commons/thumb/a/a6/Agarosegelphoto.jpg/300px-Agarosegelphoto.jpg 1.5x, //upload.wikimedia.org/wikipedia/commons/a/a6/Agarosegelphoto.jpg 2x" style="background-color: white; border: 1px solid rgb(204, 204, 204); vertical-align: middle;" width="200" /></a><span style="background-color: #f9f9f9; font-family: sans-serif; font-size: 12px; line-height: 19px; text-align: center;"></span><br />
<div class="thumbcaption" style="border: none; font-family: sans-serif; font-size: 11px; line-height: 1.4em; padding: 3px !important; text-align: left;">
<a class="internal" href="http://en.wikipedia.org/wiki/File:Agarosegelphoto.jpg" style="background-image: none !important; border: none !important; clear: right; color: #0b0080; display: block; float: right; margin-bottom: 1em; margin-left: 1em; text-decoration: none;" title="Enlarge"><img alt="" height="11" src="http://bits.wikimedia.org/static-1.23wmf12/skins/common/images/magnify-clip.png" style="background-image: none !important; border: none !important; display: block; vertical-align: middle;" width="15" /></a><div class="magnify" style="background-image: none !important; background-position: initial initial !important; background-repeat: initial initial !important; border: none !important; float: right; margin-left: 3px;">
</div>
Digital photo of the gel. Lane 1. Commercial DNA Markers (1kbplus), Lane 2. empty, Lane 3. a <a class="mw-redirect" href="http://en.wikipedia.org/wiki/PCR" style="background-image: none; text-decoration: none;" title="PCR">PCR</a> product of just over 500 bases, Lane 4.<span style="color: black;"><a href="http://en.wikipedia.org/wiki/Restriction_enzyme" style="background-image: none; text-decoration: none;" title="Restriction enzyme">Restriction</a> </span>digest showing a similar fragment cut from a 4.5 kb <a href="http://en.wikipedia.org/wiki/Plasmid" style="background-image: none; text-decoration: none;" title="Plasmid">plasmid</a>vector</div>
<div class="thumbcaption" style="border: none; font-family: sans-serif; line-height: 1.4em; padding: 3px !important; text-align: left;">
If it comes to pass that this gel is also not productive, my next step will be to combine the previous protocols of the wizard extraction kit with the Sigma-Aldrich system. Basically, as I've said before, the Sigma-Aldrich method is a "quick and dirty" extraction. I can use it initially and the use the wizard kit to "clean up" the extraction. Should I have to do this I will go into much greater detail of the why's and the how's of this next week.</div>
<div class="thumbcaption" style="border: none; line-height: 1.4em; padding: 3px !important; text-align: left;">
<!--[if gte mso 9]><xml>
<w:WordDocument>
<w:View>Normal</w:View>
<w:Zoom>0</w:Zoom>
<w:TrackMoves/>
<w:TrackFormatting/>
<w:PunctuationKerning/>
<w:ValidateAgainstSchemas/>
<w:SaveIfXMLInvalid>false</w:SaveIfXMLInvalid>
<w:IgnoreMixedContent>false</w:IgnoreMixedContent>
<w:AlwaysShowPlaceholderText>false</w:AlwaysShowPlaceholderText>
<w:DoNotPromoteQF/>
<w:LidThemeOther>ES</w:LidThemeOther>
<w:LidThemeAsian>JA</w:LidThemeAsian>
<w:LidThemeComplexScript>X-NONE</w:LidThemeComplexScript>
<w:Compatibility>
<w:BreakWrappedTables/>
<w:SnapToGridInCell/>
<w:WrapTextWithPunct/>
<w:UseAsianBreakRules/>
<w:DontGrowAutofit/>
<w:SplitPgBreakAndParaMark/>
<w:EnableOpenTypeKerning/>
<w:DontFlipMirrorIndents/>
<w:OverrideTableStyleHps/>
</w:Compatibility>
<m:mathPr>
<m:mathFont m:val="Cambria Math"/>
<m:brkBin m:val="before"/>
<m:brkBinSub m:val="--"/>
<m:smallFrac m:val="off"/>
<m:dispDef/>
<m:lMargin m:val="0"/>
<m:rMargin m:val="0"/>
<m:defJc m:val="centerGroup"/>
<m:wrapIndent m:val="1440"/>
<m:intLim m:val="subSup"/>
<m:naryLim m:val="undOvr"/>
</m:mathPr></w:WordDocument>
</xml><![endif]--><!--[if gte mso 9]><xml>
<w:LatentStyles DefLockedState="false" DefUnhideWhenUsed="true"
DefSemiHidden="true" DefQFormat="false" DefPriority="99"
LatentStyleCount="276">
<w:LsdException Locked="false" Priority="0" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Normal"/>
<w:LsdException Locked="false" Priority="9" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="heading 1"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 2"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 3"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 4"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 5"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 6"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 7"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 8"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 9"/>
<w:LsdException Locked="false" Priority="39" Name="toc 1"/>
<w:LsdException Locked="false" Priority="39" Name="toc 2"/>
<w:LsdException Locked="false" Priority="39" Name="toc 3"/>
<w:LsdException Locked="false" Priority="39" Name="toc 4"/>
<w:LsdException Locked="false" Priority="39" Name="toc 5"/>
<w:LsdException Locked="false" Priority="39" Name="toc 6"/>
<w:LsdException Locked="false" Priority="39" Name="toc 7"/>
<w:LsdException Locked="false" Priority="39" Name="toc 8"/>
<w:LsdException Locked="false" Priority="39" Name="toc 9"/>
<w:LsdException Locked="false" Priority="35" QFormat="true" Name="caption"/>
<w:LsdException Locked="false" Priority="10" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Title"/>
<w:LsdException Locked="false" Priority="1" Name="Default Paragraph Font"/>
<w:LsdException Locked="false" Priority="11" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtitle"/>
<w:LsdException Locked="false" Priority="22" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Strong"/>
<w:LsdException Locked="false" Priority="20" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Emphasis"/>
<w:LsdException Locked="false" Priority="59" SemiHidden="false"
UnhideWhenUsed="false" Name="Table Grid"/>
<w:LsdException Locked="false" UnhideWhenUsed="false" Name="Placeholder Text"/>
<w:LsdException Locked="false" Priority="1" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="No Spacing"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 1"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 1"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 1"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 1"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 1"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 1"/>
<w:LsdException Locked="false" UnhideWhenUsed="false" Name="Revision"/>
<w:LsdException Locked="false" Priority="34" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="List Paragraph"/>
<w:LsdException Locked="false" Priority="29" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Quote"/>
<w:LsdException Locked="false" Priority="30" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Quote"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 1"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 1"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 1"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 1"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 1"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 1"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 1"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 1"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 2"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 2"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 2"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 2"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 2"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 2"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 2"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 2"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 2"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 2"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 2"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 2"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 2"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 2"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 3"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 3"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 3"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 3"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 3"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 3"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 3"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 3"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 3"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 3"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 3"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 3"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 3"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 3"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 4"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 4"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 4"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 4"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 4"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 4"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 4"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 4"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 4"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 4"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 4"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 4"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 4"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 4"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 5"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 5"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 5"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 5"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 5"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 5"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 5"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 5"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 5"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 5"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 5"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 5"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 5"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 5"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 6"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 6"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 6"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 6"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 6"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 6"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 6"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 6"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 6"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 6"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 6"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 6"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 6"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 6"/>
<w:LsdException Locked="false" Priority="19" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtle Emphasis"/>
<w:LsdException Locked="false" Priority="21" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Emphasis"/>
<w:LsdException Locked="false" Priority="31" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtle Reference"/>
<w:LsdException Locked="false" Priority="32" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Reference"/>
<w:LsdException Locked="false" Priority="33" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Book Title"/>
<w:LsdException Locked="false" Priority="37" Name="Bibliography"/>
<w:LsdException Locked="false" Priority="39" QFormat="true" Name="TOC Heading"/>
</w:LatentStyles>
</xml><![endif]-->
<!--[if gte mso 10]>
<style>
/* Style Definitions */
table.MsoNormalTable
{mso-style-name:"Table Normal";
mso-tstyle-rowband-size:0;
mso-tstyle-colband-size:0;
mso-style-noshow:yes;
mso-style-priority:99;
mso-style-parent:"";
mso-padding-alt:0in 5.4pt 0in 5.4pt;
mso-para-margin-top:0in;
mso-para-margin-right:0in;
mso-para-margin-bottom:10.0pt;
mso-para-margin-left:0in;
line-height:115%;
mso-pagination:widow-orphan;
font-size:11.0pt;
font-family:Calibri;
mso-ascii-font-family:Calibri;
mso-ascii-theme-font:minor-latin;
mso-hansi-font-family:Calibri;
mso-hansi-theme-font:minor-latin;}
</style>
<![endif]-->
<!--StartFragment-->
<div class="MsoNormal" style="line-height: 200%; margin: 0in 0in 0.0001pt 0.5in; text-indent: -0.5in;">
<span style="line-height: 200%;"><span style="font-family: Times, Times New Roman, serif;">Image from: Gel electrophoresis of nucleic acids. (2014, January 25).
Retrieved February 12, 2014, from Wikipedia website:
http://en.wikipedia.org/wiki/Gel_electrophoresis_of_nucleic_acids</span></span><span style="font-family: sans-serif; font-size: 11px;"><o:p></o:p></span></div>
<div class="MsoNormal" style="font-family: sans-serif; font-size: 11px; line-height: 200%; margin: 0in 0in 0.0001pt 0.5in; text-indent: -0.5in;">
<br /></div>
<!--EndFragment--></div>
<br />
<!--[if gte mso 9]><xml>
<o:OfficeDocumentSettings>
<o:AllowPNG/>
</o:OfficeDocumentSettings>
</xml><![endif]-->
<!--[if gte mso 9]><xml>
<w:WordDocument>
<w:View>Normal</w:View>
<w:Zoom>0</w:Zoom>
<w:TrackMoves/>
<w:TrackFormatting/>
<w:PunctuationKerning/>
<w:ValidateAgainstSchemas/>
<w:SaveIfXMLInvalid>false</w:SaveIfXMLInvalid>
<w:IgnoreMixedContent>false</w:IgnoreMixedContent>
<w:AlwaysShowPlaceholderText>false</w:AlwaysShowPlaceholderText>
<w:DoNotPromoteQF/>
<w:LidThemeOther>EN-US</w:LidThemeOther>
<w:LidThemeAsian>JA</w:LidThemeAsian>
<w:LidThemeComplexScript>X-NONE</w:LidThemeComplexScript>
<w:Compatibility>
<w:BreakWrappedTables/>
<w:SnapToGridInCell/>
<w:WrapTextWithPunct/>
<w:UseAsianBreakRules/>
<w:DontGrowAutofit/>
<w:SplitPgBreakAndParaMark/>
<w:EnableOpenTypeKerning/>
<w:DontFlipMirrorIndents/>
<w:OverrideTableStyleHps/>
<w:UseFELayout/>
</w:Compatibility>
<m:mathPr>
<m:mathFont m:val="Cambria Math"/>
<m:brkBin m:val="before"/>
<m:brkBinSub m:val="--"/>
<m:smallFrac m:val="off"/>
<m:dispDef/>
<m:lMargin m:val="0"/>
<m:rMargin m:val="0"/>
<m:defJc m:val="centerGroup"/>
<m:wrapIndent m:val="1440"/>
<m:intLim m:val="subSup"/>
<m:naryLim m:val="undOvr"/>
</m:mathPr></w:WordDocument>
</xml><![endif]--><!--[if gte mso 9]><xml>
<w:LatentStyles DefLockedState="false" DefUnhideWhenUsed="true"
DefSemiHidden="true" DefQFormat="false" DefPriority="99"
LatentStyleCount="276">
<w:LsdException Locked="false" Priority="0" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Normal"/>
<w:LsdException Locked="false" Priority="9" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="heading 1"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 2"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 3"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 4"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 5"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 6"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 7"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 8"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 9"/>
<w:LsdException Locked="false" Priority="39" Name="toc 1"/>
<w:LsdException Locked="false" Priority="39" Name="toc 2"/>
<w:LsdException Locked="false" Priority="39" Name="toc 3"/>
<w:LsdException Locked="false" Priority="39" Name="toc 4"/>
<w:LsdException Locked="false" Priority="39" Name="toc 5"/>
<w:LsdException Locked="false" Priority="39" Name="toc 6"/>
<w:LsdException Locked="false" Priority="39" Name="toc 7"/>
<w:LsdException Locked="false" Priority="39" Name="toc 8"/>
<w:LsdException Locked="false" Priority="39" Name="toc 9"/>
<w:LsdException Locked="false" Priority="35" QFormat="true" Name="caption"/>
<w:LsdException Locked="false" Priority="10" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Title"/>
<w:LsdException Locked="false" Priority="1" Name="Default Paragraph Font"/>
<w:LsdException Locked="false" Priority="11" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtitle"/>
<w:LsdException Locked="false" Priority="22" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Strong"/>
<w:LsdException Locked="false" Priority="20" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Emphasis"/>
<w:LsdException Locked="false" Priority="59" SemiHidden="false"
UnhideWhenUsed="false" Name="Table Grid"/>
<w:LsdException Locked="false" UnhideWhenUsed="false" Name="Placeholder Text"/>
<w:LsdException Locked="false" Priority="1" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="No Spacing"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 1"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 1"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 1"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 1"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 1"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 1"/>
<w:LsdException Locked="false" UnhideWhenUsed="false" Name="Revision"/>
<w:LsdException Locked="false" Priority="34" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="List Paragraph"/>
<w:LsdException Locked="false" Priority="29" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Quote"/>
<w:LsdException Locked="false" Priority="30" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Quote"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 1"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 1"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 1"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 1"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 1"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 1"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 1"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 1"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 2"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 2"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 2"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 2"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 2"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 2"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 2"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 2"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 2"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 2"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 2"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 2"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 2"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 2"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 3"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 3"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 3"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 3"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 3"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 3"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 3"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 3"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 3"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 3"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 3"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 3"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 3"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 3"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 4"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 4"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 4"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 4"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 4"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 4"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 4"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 4"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 4"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 4"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 4"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 4"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 4"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 4"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 5"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 5"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 5"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 5"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 5"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 5"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 5"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 5"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 5"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 5"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 5"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 5"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 5"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 5"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 6"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 6"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 6"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 6"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 6"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 6"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 6"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 6"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 6"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 6"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 6"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 6"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 6"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 6"/>
<w:LsdException Locked="false" Priority="19" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtle Emphasis"/>
<w:LsdException Locked="false" Priority="21" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Emphasis"/>
<w:LsdException Locked="false" Priority="31" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtle Reference"/>
<w:LsdException Locked="false" Priority="32" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Reference"/>
<w:LsdException Locked="false" Priority="33" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Book Title"/>
<w:LsdException Locked="false" Priority="37" Name="Bibliography"/>
<w:LsdException Locked="false" Priority="39" QFormat="true" Name="TOC Heading"/>
</w:LatentStyles>
</xml><![endif]-->
<!--[if gte mso 10]>
<style>
/* Style Definitions */
table.MsoNormalTable
{mso-style-name:"Table Normal";
mso-tstyle-rowband-size:0;
mso-tstyle-colband-size:0;
mso-style-noshow:yes;
mso-style-priority:99;
mso-style-parent:"";
mso-padding-alt:0in 5.4pt 0in 5.4pt;
mso-para-margin:0in;
mso-para-margin-bottom:.0001pt;
mso-pagination:widow-orphan;
font-size:12.0pt;
font-family:Cambria;
mso-ascii-font-family:Cambria;
mso-ascii-theme-font:minor-latin;
mso-hansi-font-family:Cambria;
mso-hansi-theme-font:minor-latin;}
</style>
<![endif]-->
<!--StartFragment--><!--EndFragment-->
<!--[if gte mso 9]><xml>
<o:OfficeDocumentSettings>
<o:AllowPNG/>
</o:OfficeDocumentSettings>
</xml><![endif]-->
<!--[if gte mso 9]><xml>
<w:WordDocument>
<w:View>Normal</w:View>
<w:Zoom>0</w:Zoom>
<w:TrackMoves/>
<w:TrackFormatting/>
<w:PunctuationKerning/>
<w:ValidateAgainstSchemas/>
<w:SaveIfXMLInvalid>false</w:SaveIfXMLInvalid>
<w:IgnoreMixedContent>false</w:IgnoreMixedContent>
<w:AlwaysShowPlaceholderText>false</w:AlwaysShowPlaceholderText>
<w:DoNotPromoteQF/>
<w:LidThemeOther>EN-US</w:LidThemeOther>
<w:LidThemeAsian>JA</w:LidThemeAsian>
<w:LidThemeComplexScript>X-NONE</w:LidThemeComplexScript>
<w:Compatibility>
<w:BreakWrappedTables/>
<w:SnapToGridInCell/>
<w:WrapTextWithPunct/>
<w:UseAsianBreakRules/>
<w:DontGrowAutofit/>
<w:SplitPgBreakAndParaMark/>
<w:EnableOpenTypeKerning/>
<w:DontFlipMirrorIndents/>
<w:OverrideTableStyleHps/>
<w:UseFELayout/>
</w:Compatibility>
<m:mathPr>
<m:mathFont m:val="Cambria Math"/>
<m:brkBin m:val="before"/>
<m:brkBinSub m:val="--"/>
<m:smallFrac m:val="off"/>
<m:dispDef/>
<m:lMargin m:val="0"/>
<m:rMargin m:val="0"/>
<m:defJc m:val="centerGroup"/>
<m:wrapIndent m:val="1440"/>
<m:intLim m:val="subSup"/>
<m:naryLim m:val="undOvr"/>
</m:mathPr></w:WordDocument>
</xml><![endif]--><!--[if gte mso 9]><xml>
<w:LatentStyles DefLockedState="false" DefUnhideWhenUsed="true"
DefSemiHidden="true" DefQFormat="false" DefPriority="99"
LatentStyleCount="276">
<w:LsdException Locked="false" Priority="0" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Normal"/>
<w:LsdException Locked="false" Priority="9" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="heading 1"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 2"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 3"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 4"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 5"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 6"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 7"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 8"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 9"/>
<w:LsdException Locked="false" Priority="39" Name="toc 1"/>
<w:LsdException Locked="false" Priority="39" Name="toc 2"/>
<w:LsdException Locked="false" Priority="39" Name="toc 3"/>
<w:LsdException Locked="false" Priority="39" Name="toc 4"/>
<w:LsdException Locked="false" Priority="39" Name="toc 5"/>
<w:LsdException Locked="false" Priority="39" Name="toc 6"/>
<w:LsdException Locked="false" Priority="39" Name="toc 7"/>
<w:LsdException Locked="false" Priority="39" Name="toc 8"/>
<w:LsdException Locked="false" Priority="39" Name="toc 9"/>
<w:LsdException Locked="false" Priority="35" QFormat="true" Name="caption"/>
<w:LsdException Locked="false" Priority="10" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Title"/>
<w:LsdException Locked="false" Priority="1" Name="Default Paragraph Font"/>
<w:LsdException Locked="false" Priority="11" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtitle"/>
<w:LsdException Locked="false" Priority="22" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Strong"/>
<w:LsdException Locked="false" Priority="20" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Emphasis"/>
<w:LsdException Locked="false" Priority="59" SemiHidden="false"
UnhideWhenUsed="false" Name="Table Grid"/>
<w:LsdException Locked="false" UnhideWhenUsed="false" Name="Placeholder Text"/>
<w:LsdException Locked="false" Priority="1" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="No Spacing"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 1"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 1"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 1"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 1"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 1"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 1"/>
<w:LsdException Locked="false" UnhideWhenUsed="false" Name="Revision"/>
<w:LsdException Locked="false" Priority="34" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="List Paragraph"/>
<w:LsdException Locked="false" Priority="29" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Quote"/>
<w:LsdException Locked="false" Priority="30" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Quote"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 1"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 1"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 1"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 1"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 1"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 1"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 1"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 1"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 2"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 2"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 2"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 2"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 2"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 2"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 2"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 2"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 2"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 2"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 2"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 2"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 2"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 2"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 3"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 3"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 3"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 3"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 3"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 3"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 3"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 3"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 3"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 3"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 3"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 3"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 3"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 3"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 4"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 4"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 4"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 4"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 4"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 4"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 4"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 4"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 4"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 4"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 4"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 4"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 4"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 4"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 5"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 5"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 5"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 5"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 5"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 5"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 5"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 5"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 5"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 5"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 5"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 5"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 5"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 5"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 6"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 6"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 6"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 6"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 6"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 6"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 6"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 6"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 6"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 6"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 6"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 6"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 6"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 6"/>
<w:LsdException Locked="false" Priority="19" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtle Emphasis"/>
<w:LsdException Locked="false" Priority="21" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Emphasis"/>
<w:LsdException Locked="false" Priority="31" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtle Reference"/>
<w:LsdException Locked="false" Priority="32" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Reference"/>
<w:LsdException Locked="false" Priority="33" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Book Title"/>
<w:LsdException Locked="false" Priority="37" Name="Bibliography"/>
<w:LsdException Locked="false" Priority="39" QFormat="true" Name="TOC Heading"/>
</w:LatentStyles>
</xml><![endif]-->
<!--[if gte mso 10]>
<style>
/* Style Definitions */
table.MsoNormalTable
{mso-style-name:"Table Normal";
mso-tstyle-rowband-size:0;
mso-tstyle-colband-size:0;
mso-style-noshow:yes;
mso-style-priority:99;
mso-style-parent:"";
mso-padding-alt:0in 5.4pt 0in 5.4pt;
mso-para-margin:0in;
mso-para-margin-bottom:.0001pt;
mso-pagination:widow-orphan;
font-size:12.0pt;
font-family:Cambria;
mso-ascii-font-family:Cambria;
mso-ascii-theme-font:minor-latin;
mso-hansi-font-family:Cambria;
mso-hansi-theme-font:minor-latin;}
</style>
<![endif]-->
<!--StartFragment--><!--EndFragment-->
<!--[if gte mso 9]><xml>
<o:OfficeDocumentSettings>
<o:AllowPNG/>
</o:OfficeDocumentSettings>
</xml><![endif]-->
<!--[if gte mso 9]><xml>
<w:WordDocument>
<w:View>Normal</w:View>
<w:Zoom>0</w:Zoom>
<w:TrackMoves/>
<w:TrackFormatting/>
<w:PunctuationKerning/>
<w:ValidateAgainstSchemas/>
<w:SaveIfXMLInvalid>false</w:SaveIfXMLInvalid>
<w:IgnoreMixedContent>false</w:IgnoreMixedContent>
<w:AlwaysShowPlaceholderText>false</w:AlwaysShowPlaceholderText>
<w:DoNotPromoteQF/>
<w:LidThemeOther>EN-US</w:LidThemeOther>
<w:LidThemeAsian>JA</w:LidThemeAsian>
<w:LidThemeComplexScript>X-NONE</w:LidThemeComplexScript>
<w:Compatibility>
<w:BreakWrappedTables/>
<w:SnapToGridInCell/>
<w:WrapTextWithPunct/>
<w:UseAsianBreakRules/>
<w:DontGrowAutofit/>
<w:SplitPgBreakAndParaMark/>
<w:EnableOpenTypeKerning/>
<w:DontFlipMirrorIndents/>
<w:OverrideTableStyleHps/>
<w:UseFELayout/>
</w:Compatibility>
<m:mathPr>
<m:mathFont m:val="Cambria Math"/>
<m:brkBin m:val="before"/>
<m:brkBinSub m:val="--"/>
<m:smallFrac m:val="off"/>
<m:dispDef/>
<m:lMargin m:val="0"/>
<m:rMargin m:val="0"/>
<m:defJc m:val="centerGroup"/>
<m:wrapIndent m:val="1440"/>
<m:intLim m:val="subSup"/>
<m:naryLim m:val="undOvr"/>
</m:mathPr></w:WordDocument>
</xml><![endif]--><!--[if gte mso 9]><xml>
<w:LatentStyles DefLockedState="false" DefUnhideWhenUsed="true"
DefSemiHidden="true" DefQFormat="false" DefPriority="99"
LatentStyleCount="276">
<w:LsdException Locked="false" Priority="0" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Normal"/>
<w:LsdException Locked="false" Priority="9" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="heading 1"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 2"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 3"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 4"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 5"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 6"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 7"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 8"/>
<w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 9"/>
<w:LsdException Locked="false" Priority="39" Name="toc 1"/>
<w:LsdException Locked="false" Priority="39" Name="toc 2"/>
<w:LsdException Locked="false" Priority="39" Name="toc 3"/>
<w:LsdException Locked="false" Priority="39" Name="toc 4"/>
<w:LsdException Locked="false" Priority="39" Name="toc 5"/>
<w:LsdException Locked="false" Priority="39" Name="toc 6"/>
<w:LsdException Locked="false" Priority="39" Name="toc 7"/>
<w:LsdException Locked="false" Priority="39" Name="toc 8"/>
<w:LsdException Locked="false" Priority="39" Name="toc 9"/>
<w:LsdException Locked="false" Priority="35" QFormat="true" Name="caption"/>
<w:LsdException Locked="false" Priority="10" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Title"/>
<w:LsdException Locked="false" Priority="1" Name="Default Paragraph Font"/>
<w:LsdException Locked="false" Priority="11" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtitle"/>
<w:LsdException Locked="false" Priority="22" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Strong"/>
<w:LsdException Locked="false" Priority="20" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Emphasis"/>
<w:LsdException Locked="false" Priority="59" SemiHidden="false"
UnhideWhenUsed="false" Name="Table Grid"/>
<w:LsdException Locked="false" UnhideWhenUsed="false" Name="Placeholder Text"/>
<w:LsdException Locked="false" Priority="1" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="No Spacing"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 1"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 1"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 1"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 1"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 1"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 1"/>
<w:LsdException Locked="false" UnhideWhenUsed="false" Name="Revision"/>
<w:LsdException Locked="false" Priority="34" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="List Paragraph"/>
<w:LsdException Locked="false" Priority="29" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Quote"/>
<w:LsdException Locked="false" Priority="30" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Quote"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 1"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 1"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 1"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 1"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 1"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 1"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 1"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 1"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 2"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 2"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 2"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 2"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 2"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 2"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 2"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 2"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 2"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 2"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 2"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 2"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 2"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 2"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 3"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 3"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 3"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 3"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 3"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 3"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 3"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 3"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 3"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 3"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 3"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 3"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 3"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 3"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 4"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 4"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 4"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 4"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 4"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 4"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 4"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 4"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 4"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 4"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 4"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 4"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 4"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 4"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 5"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 5"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 5"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 5"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 5"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 5"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 5"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 5"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 5"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 5"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 5"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 5"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 5"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 5"/>
<w:LsdException Locked="false" Priority="60" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Shading Accent 6"/>
<w:LsdException Locked="false" Priority="61" SemiHidden="false"
UnhideWhenUsed="false" Name="Light List Accent 6"/>
<w:LsdException Locked="false" Priority="62" SemiHidden="false"
UnhideWhenUsed="false" Name="Light Grid Accent 6"/>
<w:LsdException Locked="false" Priority="63" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 1 Accent 6"/>
<w:LsdException Locked="false" Priority="64" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Shading 2 Accent 6"/>
<w:LsdException Locked="false" Priority="65" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 1 Accent 6"/>
<w:LsdException Locked="false" Priority="66" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium List 2 Accent 6"/>
<w:LsdException Locked="false" Priority="67" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 1 Accent 6"/>
<w:LsdException Locked="false" Priority="68" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 2 Accent 6"/>
<w:LsdException Locked="false" Priority="69" SemiHidden="false"
UnhideWhenUsed="false" Name="Medium Grid 3 Accent 6"/>
<w:LsdException Locked="false" Priority="70" SemiHidden="false"
UnhideWhenUsed="false" Name="Dark List Accent 6"/>
<w:LsdException Locked="false" Priority="71" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Shading Accent 6"/>
<w:LsdException Locked="false" Priority="72" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful List Accent 6"/>
<w:LsdException Locked="false" Priority="73" SemiHidden="false"
UnhideWhenUsed="false" Name="Colorful Grid Accent 6"/>
<w:LsdException Locked="false" Priority="19" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtle Emphasis"/>
<w:LsdException Locked="false" Priority="21" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Emphasis"/>
<w:LsdException Locked="false" Priority="31" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Subtle Reference"/>
<w:LsdException Locked="false" Priority="32" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Intense Reference"/>
<w:LsdException Locked="false" Priority="33" SemiHidden="false"
UnhideWhenUsed="false" QFormat="true" Name="Book Title"/>
<w:LsdException Locked="false" Priority="37" Name="Bibliography"/>
<w:LsdException Locked="false" Priority="39" QFormat="true" Name="TOC Heading"/>
</w:LatentStyles>
</xml><![endif]-->
<!--[if gte mso 10]>
<style>
/* Style Definitions */
table.MsoNormalTable
{mso-style-name:"Table Normal";
mso-tstyle-rowband-size:0;
mso-tstyle-colband-size:0;
mso-style-noshow:yes;
mso-style-priority:99;
mso-style-parent:"";
mso-padding-alt:0in 5.4pt 0in 5.4pt;
mso-para-margin:0in;
mso-para-margin-bottom:.0001pt;
mso-pagination:widow-orphan;
font-size:12.0pt;
font-family:Cambria;
mso-ascii-font-family:Cambria;
mso-ascii-theme-font:minor-latin;
mso-hansi-font-family:Cambria;
mso-hansi-theme-font:minor-latin;}
</style>
<![endif]-->
<!--StartFragment-->
<div class="MsoNormal">
<o:p></o:p></div>
<!--EndFragment-->Matthttp://www.blogger.com/profile/06688013292496620643noreply@blogger.com0